View source for Complex locus A1BG and ZNF497

{{AE}} Henry A. Hoff

Alpha-1-B glycoprotein is a 54.3 kDa protein in humans that is encoded by the A1BG gene.<ref name="entrez">{{ cite web
| title = Entrez Gene: Alpha-1-B glycoprotein
| url = https://www.ncbi.nlm.nih.gov/sites/entrez?db=gene&cmd=retrieve&list_uids=1
| accessdate = 2012-11-09 }}</ref> The protein encoded by this gene is a plasma glycoprotein of unknown function. The protein shows sequence similarity to the variable regions of some immunoglobulin supergene family member proteins.

A1BG was located on the DNA strand of [[chromosome 19]].<ref name=A1BG>{{ cite web
|title=A1BG alpha-1-B glycoprotein
|url=https://www.ncbi.nlm.nih.gov/gene/1
|accessdate=May 10, 2013 }}</ref> Additionally, A1BG, in current nucleotide numbering (58,345,183-58,353,492), is located adjacent to the ZSCAN22 gene (58,326,994-58,342,332) on the positive DNA strand, as well as the ZNF837 (58,367,623 - 58,381,030, complement) and ZNF497 (58,354,357 - 58,362,751, complement) genes on the negative strand.<ref name=A1BG/>

In the current nucleotide numbering, the A1BG untranslated region (UTR) has been expanded so that with ZSCAN22 ending at 58,342,332, the nucleotides used in this study are 58,342,333 to 58,346,892 on both strands, with the current UTR for A1BG beginning at 58,345,183. On the other side of A1BG ending at 58,353,492, the nucleotides used are 58,353,493 to 58,357,937. With ZNF497 beginning at 58,354,357, this study goes into ZNF497 to 58,357,937 or 3580 nucleotides from its downstream TSS or 4445 nucleotides from the TSS of A1BG downstream from ZNF497.

For example, an abscissic acid responsive element (ABRE) with the consensus sequence of  ACGTG(G/T)C (Watanabe ''et al''. 2017) occurs in the positive strand in the negative direction from ZSCAN22 to A1BG as ACGTGGC ending at 4239 nucleotides from the end of ZSCAN22 or 58,346,571, where the A is at 58,346,565 inside the UTR of A1BG.

==Introduction==

"Many important disease-related pathways utilize transcription factors that specifically bind DNA (e.g., c-Myc, HIF-1, TCF1, p53) as key nodes or endpoints in complex signaling networks. In such cases the transcription factor itself is often the most attractive target. However, drugging transcription factors is challenging owing to an absence of small ligand binding sites in their DNA-binding domain and the presence of a highly charged DNA-binding surface [1]."<ref name=Li2020>{{ cite journal
|author=Qingliang Li, Rezaul M. Karim, Mo Cheng, Mousumi Das, Lihong Chen, Chen Zhang, Harshani R. Lawrence, Gary W. Daughdrill, Ernst Schonbrunn, Haitao Ji and Jiandong Chen
|title=Inhibition of p53 DNA binding by a small molecule protects mice from radiation toxicity
|journal=Oncogene
|date=July 2020
|volume=39
|issue=29
|pages=5187-5200
|url=https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7398576/
|arxiv=
|bibcode=
|doi=10.1038/s41388-020-1344-y
|pmid=32555331
|accessdate=29 August 2020 }}</ref>

If a specific gene appears to be involved in a disease-related or deleterious pathway being able to alter its expression so as to improve the person's health may be needed. To alter its expression constructively may require knowing what regulatory elements exist in the gene's nearby promoters.

==Response elements==
{{main|A1BG response element gene transcriptions}}
Identifying a bona fide response element is more difficult than a simple inspection. In order to attribute the response element to a candidate sequence, some observations have to be conducted using molecular, biological and biophysical methods and functional approaches. Findings may indicate that response element in the promoter is a functional element.<ref name=Gu>{{ cite journal
|author=Ruoyi Gu, Jun Xu, Yixiang Lin, Jing Zhang, Huijun Wang, Wei Sheng, Duan Ma, Xiaojing Ma & Guoying Huang
|title=Liganded retinoic acid X receptor α represses connexin 43 through a potential retinoic acid response element in the promoter region
|journal=Pediatric Research
|date=July 2016
|volume=80
|issue=1
|pages=159-168
|url=https://www.nature.com/articles/pr201647
|arxiv=
|bibcode=
|doi=10.1038/pr.2016.47
|pmid=26991262
|accessdate=7 September 2020 }}</ref>

A likely response element found by simple inspection may also be inactive due to methylation.

Response Elements: "Nucleotide sequences, usually upstream, which are recognized by specific regulatory transcription factors, thereby causing gene response to various regulatory agents. These elements may be found in both promoter and enhancer regions."<ref name=MeSHNote99>{{ cite web
|author=U.S. National Library of Medicine
|title=Response Elements MeSH Descriptor Data 2021
|publisher=National Institutes of Health
|location=8600 Rockville Pike, Bethesda, MD 20894
|date=8 July 2008
|url=https://meshb.nlm.nih.gov/record/ui?name=response%20element
|accessdate=22 April 2021 }}</ref>

"Under conditions of stress, a transcription activator protein binds to the response element and stimulates transcription. If the same response element sequence is located in the control regions of different genes, then these genes will be activated by the same stimuli, thus producing a coordinated response."<ref name=Pierce>{{ cite book
|author=Benjamin A. Pierce
|title=Control of Gene Expression, In: ''Genetics Solutions and Problem Solving MegaManual''
|publisher=Macmillan
|location=
|date=24 December 2004
|editor=
|pages=221
|url=https://books.google.com/books?id=sUaIpEvX9noC&pg=PA221&lpg=PA221&source=bl&ots=14s3Xszdsw&sig=ACfU3U0VV4HsN4ekDRZJO83hxj9QidiZ8w&hl=en&sa=X&ved=2ahUKEwisu8jByJPwAhXI8p4KHRgzDx4Q6AEwBHoECAEQAw#v=onepage&f=false
|arxiv=
|bibcode=
|doi=
|pmid=
|isbn=
|accessdate=22 April 2021 }}</ref>

===WD-40 repeat family===
{{main|WD-40 repeat family}}
"Receptor for activated C kinase (RACK1) is a highly conserved, eukaryotic protein of the WD-40 repeat family. [...] During ''Phaseolus vulgaris'' root development, RACK1 (PvRACK1) mRNA expression was induced by auxins, abscissic acid, cytokinin, and gibberellic acid."<ref name=Flores>{{ cite journal
|author=Tania Islas-Flores, Gabriel Guillén, Xóchitl Alvarado-Affantranger, Miguel Lara-Flores, Federico Sánchez, and Marco A. Villanueva
|title=PvRACK1 Loss-of-Function Impairs Cell Expansion and Morphogenesis in ''Phaseolus vulgaris'' L. Root Nodules
|journal=Molecular Plant-Microbe Interactions
|date=2011
|volume=24
|issue=7
|pages=819-826
|url=https://apsjournals.apsnet.org/doi/pdfplus/10.1094/MPMI-11-10-0261
|arxiv=
|bibcode=
|doi=10.1094/MPMI-11-10-0261
|pmid=
|accessdate=25 April 2021 }}</ref>

====Abscissic acid (ABA) response elements====
{{main|ABA-response element gene transcriptions#ABRE samplings}}

====Auxin response factors====
{{main|Auxin response factor gene transcriptions}}

=====ARFUs=====
{{main|Auxin response factor gene transcriptions#TGTCTC (Ulmasov) ARFbs samplings}}

=====ARFBs=====
{{main|Auxin response factor gene transcriptions#TGTCGG (Boer) ARFbs samplings}}

=====ARF2s=====
{{main|Auxin response factor gene transcriptions#ARF (Stigliani) samplings}}

=====ARF5s=====
{{main|Auxin response factor gene transcriptions#ARF5 samplings}}

====CAACTC regulatory elements====
{{main|CARE gene transcriptions}}

=====CAREs (Fan)=====
{{main|CARE gene transcriptions#CARE (Fan) sampling of A1BG promoters}}

=====CAREs (Garaeva)=====
{{main|CARE gene transcriptions#CARE (Garaeva) samplings}}

====Cytokinins====
{{main|Cytokinin response regulator gene transcriptions}}

=====ARR1s=====
{{main|Cytokinin response regulator gene transcriptions#ARR1 Cytokinin samplings}}

=====ARR10s=====
{{main|Cytokinin response regulator gene transcriptions#ARR10 Cytokinin samplings}}

=====ARR12s=====
{{main|Cytokinin response regulator gene transcriptions#ARR12 Cytokinin samplings}}

=====ARRFs=====
{{main|Cytokinin response regulator gene transcriptions#ARR (Ferreira) samplings}}

=====ARRR1s=====
{{main|Cytokinin response regulator gene transcriptions#ARR (Rashotte1) samplings}}

=====ARRR2s=====
{{main|Cytokinin response regulator gene transcriptions#ARR (Rashotte2) samplings}}

====Coupling elements====
{{main|Coupling element gene transcriptions}}

=====CE3Ws=====
{{main|Coupling element gene transcriptions#CE3 (Watanabe) samplings}}

=====CE3Ds=====
{{main|Coupling element gene transcriptions#CE3 (Ding) samplings}}

====EREs====
{{main|Ethylene responsive element gene transcriptions#ERE samplings}}

====Gibberellic acid response elements====
{{main|GARE gene transcriptions}}

=====GAREs=====
{{main|GARE gene transcriptions#GARE sampling of A1BG promoters}}

=====GAREL1s=====
{{main|GARE gene transcriptions#GARE-like 1 samplings}}

====Hypoxia response elements====
{{main|Hypoxia response element gene transcriptions}}

=====HIFs=====
{{main|Hypoxia response element gene transcriptions#Hypoxia-inducible factor samplings}}

=====HREs=====
{{main|Hypoxia response element gene transcriptions#Hypoxia response element samplings}}

=====CACAs=====
{{main|Hypoxia response element gene transcriptions#CACA samplings}}

====Pyrimidine boxes====
{{main|Pyrimidine box gene transcriptions|Nuclear factor of activated T cell gene transcriptions (NFAT)}}

====TAT boxes====
{{main|TAT box gene transcriptions}}

=====TATFs=====
{{main|TAT box gene transcriptions#TAT box (Fan) samplings}}

=====TATYs=====
{{main|TAT box gene transcriptions#TAT box (Yang) samplings}}

===General Regulatory Factors===
{{main|General regulatory factors}}
The following general regulatory factors occur in the promoters between ZSCAN22, A1BG and ZNF497 on human chromosome 19.

====Abfms====
{{main|Abf1 regulatory factor gene transcriptions}}

====Rap1s====
{{main|Rap1 regulatory factor gene transcriptions}}

====Reb1s====
{{main|Reb1 general regulatory factor gene transcriptions}}

====Tbf1s====
{{main|Tbf1 regulatory factor gene transcriptions}}

===Basic leucine zipper (bZIP) class response elements===

====A-boxes====
{{main|A box gene transcriptions}}

====ACGTs====
{{main|ACGT-containing element gene transcriptions#ACGT samplings}}
"A majority of the plant bZIP proteins isolated to date recognize elements with an ACGT core (Foster et al., 1994)."<ref name=Nijhawan>{{ cite journal | author = Nijhawan A, Jain M, Tyagi AK, Khurana JP
| title = Genomic survey and gene expression analysis of the basic leucine zipper transcription factor family in rice
| journal = Plant Physiology
| volume = 146
| issue = 2
| pages = 333–50
| date = February 2008
| pmid = 18065552
| doi = 10.1104/pp.107.112821 }}</ref>

"Most recombinant bZIP proteins can interact with ACGT elements derived from different plant genes, albeit with different affinity. Systematic protein/DNA binding studies have shown that sequences flanking the ACGT core affect bZIP protein binding specificity. These studies have provided the basis for a concise ACGT nomenclature and defined high-affinity A-box, C-box, and G-box elements."<ref name=Foster>{{ cite journal
|author=Randy Foster, Takeshi Izawa and Nam-Hai Chua
|title=Plant bZIP proteins gather at ACGT elements
|journal=FASEB
|date=1 February 1994
|volume=8
|issue=2
|pages=192-200
|url=https://faseb.onlinelibrary.wiley.com/doi/pdfdirect/10.1096/fasebj.8.2.8119490
|arxiv=
|bibcode=
|doi=10.1096/fasebj.8.2.8119490
|pmid=8119490
|accessdate=25 June 2021 }}</ref>

"HY5 binds to the promoter of light-responsive genes featuring [[ACGT-containing element gene transcriptions|"ACGT-containing elements"]] such as the G-box (CACGTG), C-box (GACGTC), Z-box (ATACGGT), and A-box (TACGTA) (4, 6)."<ref name=Nawkar>{{ cite journal
|author=Ganesh M. Nawkar, Chang Ho Kanga, Punyakishore Maibam, Joung Hun Park, Young Jun Jung, Ho Byoung Chae, Yong Hun Chi, In Jung Jung, Woe Yeon Kim, Dae-Jin Yun, and Sang Yeol Lee
|title=HY5, a positive regulator of light signaling, negatively controls the unfolded protein response in ''Arabidopsis''
|journal=Proceedings of the National Academy of Sciences USA
|date=21 February 2017
|volume=114
|issue=8
|pages=2084-89
|url=https://www.pnas.org/content/pnas/114/8/2084.full.pdf
|arxiv=
|bibcode=
|doi=10.1073/pnas.1609844114
|pmid=
|accessdate=24 June 2021 }}</ref>

====Activating transcription factors====
{{main|Activating transcription factor gene transcriptions}}

=====ATFBs=====
{{main|Activating transcription factor gene transcriptions#Activating transcription factor samplings (Burton)}}

=====ATFKs=====
{{main|Activating transcription factor gene transcriptions#Activating transcription factor samplings (Kilberg)}}

====Affinity Capture-Western; Two-hybrid transcription factors====
{{main|Aft1p gene transcriptions}}

=====AFTs=====
{{main|Aft1p gene transcriptions#AFT1 samplings}}

====Box As====
{{main|A box gene transcriptions#Box A samplings}}

====C-boxes====
{{main|C box gene transcriptions}}
C-boxes come in several varieties:

=====C-boxes (Johnson)=====
{{main|C box gene transcriptions#Johnson C-box samplings}}

=====C boxes (Samarsky)=====
{{main|C box gene transcriptions#Samarsky C box samplings}}

=====C boxes (Voronina)=====
{{main|C box gene transcriptions#Voronina C box samplings}}

=====C boxes (Song)=====
{{main|C box gene transcriptions#Song C-box samplings}}

=====C boxes (Song hybrids)=====
{{main|C box gene transcriptions#Hybrid C, G box samplings}}
Hybrids: C/A-box (TGACGTAT), C/G-box (TGACGTGT), C/T-box (TGACGTTA).

====CAMPs====
{{main|CRE box gene transcriptions#CRE samplings of the A1BG promoters}}

====ESRE====
{{main|Endoplasmic reticulum stress response element gene transcriptions}}
The endoplasmic reticulum stress response element (ESRE) has two parts: (1) CCAAT and (2) CCACG which are tested separately then compared to see if any parts have any nine nucleotides between them.

=====CCAAT=====
{{main|Endoplasmic reticulum stress response element gene transcriptions#CCAAT samplings}}

=====CCACG=====
{{main|Endoplasmic reticulum stress response element gene transcriptions#CCACG samplings}}

According to So (2018) the endoplasmic reticulum stress response element should be CCAAT-N9-CCACG. Samplings demonstrate that the ideal CCAAT-N9-CCACG or its complement inverse do not occur on either side of A1BG or close to ZSCAN22 or ZNF497.

====Hap motif====
{{main|CAAT box gene transcriptions#Heme-activated protein (Hap) samplings|Endoplasmic reticulum stress response element gene transcriptions#CCAAT samplings}}

====G-boxes====
{{main|G box gene transcriptions}}

=====G-box (CACGTG)=====
{{main|Phosphate starvation-response transcription factor gene transcriptions#Pho samplings|Complex locus A1BG and ZNF497#Phors}}

====GCN4 motif====
{{main|Gcn4p gene transcriptions}}

=====GCREs (Gcn4)=====
{{main|Gcn4p gene transcriptions#GCRE samplings}}

====Migs====
{{main|Mig1p gene transcriptions}}

====Nuclear factors====
{{main|Nuclear factor gene transcriptions}}

=====NFATs=====
{{main|Nuclear factor of activated T cell gene transcriptions (NFAT)#NFAT samplings}}

=====HNF6s=====
{{main|HNF gene transcriptions#HNF6 samplings}}

====T boxes====
{{main|T box gene transcriptions}}

=====TboxCs=====
{{main|T box gene transcriptions#T box (Conlon) samplings}}

=====TboxZs=====
{{main|T box gene transcriptions#T box (Zhang) samplings}}

====Vboxes====
{{main|V box gene transcriptions#V box samplings}}

====Z-boxes====
{{main|Z box gene transcriptions}}

=====ZboxGs=====
{{main|Z box gene transcriptions#General Z-box (ZboxG) samplings}}

=====ZboxSps=====
{{main|Z box gene transcriptions#Z-box (ZboxSp) samplings}}

===Helix-turn-helix (HTH) transcription factors===
{{main|Helix-turn-helix transcription factors}}
Gene ID: 4602 is MYB [myeloblastosis] MYB proto-oncogene, transcription factor on 6q23.3: "This gene encodes a protein with three HTH DNA-binding domains that functions as a transcription regulator. This protein plays an essential role in the regulation of hematopoiesis. This gene may be aberrently expressed or rearranged or undergo translocation in leukemias and lymphomas, and is considered to be an oncogene. Alternative splicing results in multiple transcript variants."<ref name=RefSeq4602>{{ cite web
|author=RefSeq
|title=MYB MYB proto-oncogene, transcription factor [ Homo sapiens (human) ]
|publisher=National Center for Biotechnology Information, U.S. National Library of Medicine
|location=8600 Rockville Pike, Bethesda MD, 20894 USA
|date=January 2016
|url=https://www.ncbi.nlm.nih.gov/gene/4602
|accessdate=7 February 2021 }}</ref>

====CadC binding domains====
{{main|CadC binding domain gene transcriptions#Cadaverine C samplings}}

====Factor II B recognition elements====
{{main|Factor II B recognition element gene transcriptions#BREu samplings}}

====Forkhead boxes====
{{main|Forkhead box gene transcriptions#Forkhead box samplings}}

====Homeoboxes====
{{main|Homeobox gene transcriptions#Homeobox samplings}}

====Homeodomains====
{{main|Homeobox gene transcriptions#Homeodomain samplings}}

====HSE3 (Eastmond)====
{{main|Hsf1p gene transcriptions#HSE3 (Eastmond) samplings}}

====HSE4 (Eastmond)====
{{main|Hsf1p gene transcriptions#HSE4 (Eastmond) samplings}}

====HSE8 GAP1 (Eastmond)====
{{main|Hsf1p gene transcriptions#HSE8 GAP1 (Eastmond) samplings}}

====HSE9 GAP2 (Eastmond)====
{{main|Hsf1p gene transcriptions#HSE9 GAP2 (Eastmond) samplings}}

====Hsf (Tang)====
{{main|Hsf1p gene transcriptions#Hsf (Tang) samplings}}

====MREs====
{{main|MYB recognition element gene transcriptions#MRE samplings}}

====Tryptophan residues====
{{main|Interferon regulatory factor gene transcriptions#Tryptophan residue samplings}}

===Basic helix-loop-helix (bHLH) transcription factors===
{{main|Basic helix–loop–helix}}
"The [palindromic E-box motif (CACGTG)] motif is bound by the transcription factor Pho4, [and has the] class of basic helix-loop-helix DNA binding domain and core recognition sequence (Zhou and O'Shea 2011)."<ref name=Rossi>{{ cite journal
|author=Matthew J. Rossi, William K.M. Lai and B. Franklin Pugh
|title=Genome-wide determinants of sequence-specific DNA binding of general regulatory factors
|journal=Genome Research
|date=21 March 2018
|volume=28
|issue=
|pages=497-508
|url=https://genome.cshlp.org/content/28/4/497.full
|arxiv=
|bibcode=
|doi=10.1101/gr.229518.117
|pmid=29563167
|accessdate=31 August 2020 }}</ref>

"Pho4 bound to virtually all E-boxes ''in vitro'' (96%) [...]. That was not the case ''in vivo'', where only 5% were bound by Pho4, under activating conditions as determined by ChIP-seq [Zhou and O'Shea 2011]."<ref name=Rossi/>

"Pho4 possesses the intrinsic ability to bind every E-box, but ''in vivo'' is prevented from binding by chromatin unless assisted by chromatin remodelers (Svaren ''et al.'' 1994) that are targeted at promoter regions."<ref name=Rossi/>

"On one end of that spectrum, typical transcription factors like Pho4 do not appear to compete with nucleosomes and instead predominantly sample motifs that already exist in the [nucleosome-free promoter regions] NFRs generated by other factors. In vitro (PB-exo), Pho4 bound nearly every instance of an E-box motif across the yeast genome. However, in vivo, Pho4 is a low-abundance protein that is recruited to the nucleus upon phosphate starvation by other factors, to act at a few dozen genes (Komeili and O'Shea 1999; Zhou and O'Shea 2011). Since Pho4 appears unable to compete with nucleosomes, competent sites that are occluded by nucleosomes are invisible to Pho4."<ref name=Rossi/>

The Pho4 homodimer binds to DNA sequences containing the bHLH binding site CACGTG.<ref name=Shao>{{ cite journal
|author=Dalei Shao, Caretha L. Creasy, Lawrence W. Bergman
|title = A cysteine residue in helixII of the bHLH domain is essential for homodimerization of the yeast transcription factor Pho4p
|journal = Nucleic Acids Research
|volume = 26
|issue = 3
|pages = 710–4
|date= 1 February 1998
|pmid = 9443961
|pmc = 147311
|doi = 10.1093/nar/26.3.710
|url = https://academic.oup.com/nar/article/26/3/710/1052045 }}</ref>

The upstream activating sequence (UAS) for Pho4p is CAC(A/G)T(T/G) in the promoters of ''HIS4'' and ''PHO5'' regarding phosphate limitation with respect to regulation of the purine and histidine biosynthesis pathways [66].<ref name=Tang>{{ cite journal
|author=Hongting Tang, Yanling Wu, Jiliang Deng, Nanzhu Chen, Zhaohui Zheng, Yongjun Wei, Xiaozhou Luo, and Jay D. Keasling
|title=Promoter Architecture and Promoter Engineering in ''Saccharomyces cerevisiae''
|journal=Metabolites
|date=6 August 2020
|volume=10
|issue=8
|pages=320-39
|url=https://www.mdpi.com/2218-1989/10/8/320/pdf
|arxiv=
|bibcode=
|doi=10.3390/metabo10080320
|pmid=32781665
|accessdate=18 September 2020 }}</ref>

bHLH proteins typically bind to a consensus sequence called an E-box, CANNTG.<ref name="pmid10319327">{{cite journal |author=Chaudhary J, Skinner MK |title=Basic helix-loop-helix proteins can act at the E-box within the serum response element of the c-fos promoter to influence hormone-induced promoter activation in Sertoli cells |journal=Mol. Endocrinol. |volume=13 |issue=5 |pages=774–86 |date=1999 |pmid=10319327 |doi=10.1210/mend.13.5.0271 }}</ref>

"A computer search for transcription promoter elements [...] showed the presence of a prominent TATA box 22 nucleotides upstream of the transcription start site and an [[Sp1]] site at position -42 to -33. The 5'-flanking sequence also contains three E boxes with CANNTG consensus sequences at positions -464 to -459, -90 to -85, and -52 to -47 that have been marked as [[E box]], [[E1 box]], and [[E2 box]], respectively [...]. In addition, the 5'-flanking region contains one or more [[GRE]], [[Aryl hydrocarbon receptor#DNA binding (xenobiotic response element – XRE)|XRE]], [[GATA1|GATA-1]], [[ATF4|GCN-4]], [[ETV4|PEA-3]], [[AP-1 (transcription factor)|AP1]], and [[Activating protein 2|AP2]] consensus motifs and also three imperfect CArG sites [...]."<ref name=Lenka>{{ cite journal
|author=Nibedita Lenka, Aruna Basu, Jayati Mullick, and Narayan G. Avadhani
|title=The role of an E box binding basic helix loop helix protein in the cardiac muscle-specific expression of the rat cytochrome oxidase subunit VIII gene
|journal=The Journal of Biological Chemistry
|date=22 November 1996
|volume=271
|issue=47
|pages=30281–30289
|url=http://www.jbc.org/content/271/47/30281.full.pdf
|arxiv=
|bibcode=
|doi=10.1074/jbc.271.47.30281
|pmid=
|accessdate=7 February 2019 }}</ref>

====AhRYs====
{{main|Xenobiotic response element gene transcriptions#TCDD*AhR DNA-binding consensus sequence sampling}}

====AHRE-IIs====
{{main|Xenobiotic responsive element gene transcriptions#AHRE-II samplings}}

====AEREs====
{{main|Antioxidant-electrophile responsive element gene transcriptions#AERE (Lacher) samplings}}

====CAT boxes====
{{main|CAT box gene transcriptions#CAT box samplings}}

====CAT-box-like elements====
{{main|CAT box gene transcriptions#CAT-box-like element samplings}}

===="Class C"====
{{main|N box gene transcriptions#"Class C" (Leal) samplings}}

===="Class I"====

=====TCFs=====
{{main|Transcription factor 3 gene transcriptions#TCF3 samplings}}

====DIOXs====
{{main|Xenobiotic response element gene transcriptions#DIOX samplings}}

====Enhancer boxes====
{{main|Enhancer box gene transcriptions#Enhancer box samplings}}

=====ChoRE motifs=====
{{main|Carbohydrate response element gene transcriptions}}

=====CarbE1s=====
{{main|Carbohydrate response element gene transcriptions#ATCTTG (CarbE1) samplings}}

=====CarbE2s=====
{{main|Carbohydrate response element gene transcriptions#CACGTG (CarbE2) samplings}}

=====CarbE3s=====
{{main|Carbohydrate response element gene transcriptions#TCCGCC (CarbE3) samplings}}

=====Phors=====
{{main|Phosphate starvation-response transcription factor gene transcriptions#Pho samplings}}
Palindromic E-box motif (CACGTG).

=====E2 boxes=====
{{main|E2 box gene transcriptions#E2 box samplings}}

====GATAs====
{{main|GATA gene transcriptions#GATA samplings}}

====Gln3s====
{{main|GATA gene transcriptions#Staschke Gln3 samplings}}

====Glucocorticoid response elements====
{{main|Glucocorticoid response element gene transcriptions#Glu samplings}}

====ICRE (Lopes)====
{{main|Inositol, choline-responsive element gene transcriptions}}

====ICRE (Schwank)====
{{main|Inositol, choline-responsive element gene transcriptions}}

====Pho4====
{{main|Phosphate starvation-response transcription factor gene transcriptions#Phop samplings}}

====QRDREs====
{{main|Xenobiotic response element gene transcriptions#QRDRE samplings}}

====Carbon source-responsive elements====
{{main|Carbon source-responsive element gene transcriptions}}

=====CATTCAs=====
{{main|Carbon source-responsive element gene transcriptions#CATTCA samplings}}

=====TCCGs=====
{{main|Carbon source-responsive element gene transcriptions#TCCG samplings}}

====XREs====
{{main|Xenobiotic response element gene transcriptions#Xenobiotic response element samplings}}

===Basic helix-loop-helix leucine zipper transcription factors===

Basic helix-loop-helix leucine zipper transcription factors are, as their name indicates, transcription factors containing both [[Basic helix-loop-helix]] and [[leucine zipper]] motifs.

Examples include [[Microphthalmia-associated transcription factor]] and [[Sterol regulatory element-binding protein]] (SREBP).

MITF recognizes E-box (CAYRTG) and M-box (TCAYRTG or CAYRTGA) sequences in the promoter regions of target genes.<ref name=Hoek>{{cite journal | author = Hoek KS, Schlegel NC, Eichhoff OM, Widmer DS, Praetorius C, Einarsson SO, Valgeirsdottir S, Bergsteinsdottir K, Schepsky A, Dummer R, Steingrimsson E | title = Novel MITF targets identified using a two-step DNA microarray strategy | journal = Pigment Cell Melanoma Res. | volume = 21 | issue = 6 | pages = 665–76 | date = 2008 | pmid = 19067971 | doi = 10.1111/j.1755-148X.2008.00505.x }}</ref>

[[Serum response element gene transcriptions]]: The SRE wild type (SREwt) contains the nucleotide sequence ACAGGATGTCCATATTAGGACATCTGC, of which CCATATTAGG is the CArG box, TTAGGACAT is the C/EBP box, and CATCTG is the E box.<ref name=Misra>{{ cite journal
|author=Ravi P. Misra
|author2=Azad Bonni
|author3=Cindy K. Miranti
|author4=Victor M. Rivera
|author5=Morgan Sheng
|author6=Michael E.Greenberg
|title=L-type Voltage-sensitive Calcium Channel Activation Stimulates Gene Expression by a Serum Response Factor-dependent Pathway
|journal=The Journal of Biological Chemistry
|date=14 October 1994
|volume=269
|issue=41
|pages=25483-25493
|url=http://www.jbc.org/content/269/41/25483.full.pdf
|arxiv=
|bibcode=
|doi=
|pmid=7929249
|accessdate=7 December 2019 }}</ref>

"Serum response factor (SRF) is an important transcription factor that regulates cardiac and skeletal muscle genes during development, maturation and adult aging [17,18]. SRF regulates its target genes by binding to serum response elements (SREs), which contain a consensus CC(A/T)<sub>6</sub>GG (CArG) motif."<ref name=Zhang2017>{{ cite journal
|author=Xiaomin Zhang, Gohar Azhar, Jeanne Y. Wei
|title=SIRT2 gene has a classic SRE element, is a downstream target of serum response factor and is likely activated during serum stimulation
|journal=PLOS One
|date=21 December 2017
|volume=12
|issue=12
|pages=e0190011
|url=https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0190011
|arxiv=
|bibcode=
|doi=10.1371/journal.pone.0190011
|pmid=
|accessdate=23 February 2021 }}</ref>

====CArG boxes====
{{main|CArG box gene transcriptions#CArG box samplings}}

====MITF E-boxes====
{{main|Enhancer box gene transcriptions#MITF E-box (CAYRTG) samplings}}

=====RREs=====
{{main|MYB recognition element gene transcriptions#RRE samplings}}
Consensus sequence: CATCTG.

====M-boxes====
{{main|M box gene transcriptions}}

=====M box (Bertolotto)=====
{{main|M box gene transcriptions#M box (Bertolotto) samplings}}

=====M-box (Hoek)=====
{{main|M box gene transcriptions#M-box (Hoek) samplings}}

=====M-box (Ripoll)=====
{{main|M box gene transcriptions#M-box (Ripoll) samplings}}

====SER elements====
{{main|Serum response element gene transcriptions#SER samplings}}

===Basic helix-span-helix===

====Activating proteins====
{{main|Activating protein gene transcriptions}}

=====AP2as=====
{{main|Activating protein gene transcriptions#AP-2 alpha consensus sequences}}

=====APCo1s=====
{{main|Activating protein gene transcriptions#Activating protein samplings (Cohen)}}

=====APCo2s=====
{{main|Activating protein gene transcriptions#Activating protein (Cohen2) samplings}}

=====APM3Ns=====
{{main|Activating protein gene transcriptions#Activating protein samplings (Murata, 3N)}}

=====APM4Ns=====
{{main|Activating protein gene transcriptions#Activating protein samplings (Murata, 4N)}}

=====Yao1s=====
{{main|Activating protein gene transcriptions#Activating protein samplings (Yao1)}}

=====Yao2s=====
{{main|Activating protein gene transcriptions#Activating protein samplings (Yao2)}}

=====Yau3s=====
{{main|Activating protein gene transcriptions#Activating protein samplings (Yao3)}}
"[[Pemphigus foliaceus]] (PF) is an autoimmune disease, endemic in Brazilian rural areas, characterized by acantholysis and accompanied by complement activation, with generalized or localized distribution of painful epidermal blisters. [[CD59]] is an essential complement regulator, inhibiting formation of the membrane attack complex, and mediating signal transduction and activation of T lymphocytes. ''CD59'' has different transcripts by alternative splicing, of which only two are widely expressed, suggesting the presence of regulatory sites in their noncoding regions. To date, there is no association study with polymorphisms in ''CD59'' noncoding regions and susceptibility to autoimmune diseases. In this study, we aimed to evaluate if ''CD59'' polymorphisms have a possible regulatory effect on gene expression and susceptibility to PF. Six noncoding polymorphisms were haplotyped in 157 patients and 215 controls by sequence-specific [[polymerase chain reaction|PCR]], and CD59 mRNA levels were measured in 82 subjects, by qPCR. The ''rs861256-allele-G'' (''rs861256*G'') was associated with increased mRNA expression (''p'' = .0113) and PF susceptibility in women (OR = 4.11, ''p'' = .0001), which were also more prone to develop generalized lesions (OR = 4.3, ''p'' = .009) and to resist disease remission (OR = 3.69, ''p'' = .045). Associations were also observed for ''rs831625*G'' (OR = 3.1, ''p'' = .007) and ''rs704697*A'' (OR = 3.4, ''p'' = .006) in Euro-Brazilian women, and for ''rs704701*C'' (OR = 2.33, ''p'' = .037) in Afro-Brazilians. These alleles constitute the ''GGCCAA'' haplotype, which also increases PF susceptibility (OR = 4.9, ''p'' = .045) and marks higher mRNA expression (''p'' = .0025). [...] higher ''CD59'' transcriptional levels may be related with PF susceptibility (especially in women), probably due to the effect of genetic polymorphism and to the CD59 role in T cell signal transduction."<ref name=Silva>{{ cite journal
|author=Amanda Salviano-Silva, Maria Luiza Petzl-Erler & Angelica Beate Winter Boldt
|title=''CD59'' polymorphisms are associated with gene expression and different sexual susceptibility to pemphigus foliaceus
|journal=Autoimmunity
|date=29 April 2017
|volume=50
|issue=6
|pages=377-385
|url=https://www.tandfonline.com/doi/abs/10.1080/08916934.2017.1329830
|arxiv=
|bibcode=
|doi=10.1080/08916934.2017.1329830
|pmid=
|accessdate=27 September 2021 }}</ref>

===Stem-loops===
[[Image:Stem-loop.svg|thumb|right|300px|An example of an RNA stem-loop is shown. Credit: [[c:user:Sakurambo|Sakurambo]].{{tlx|free media}}]]
As an important secondary structure of RNA, a stem-loop can direct RNA folding, protect structural stability for messenger RNA (mRNA), provide recognition sites for RNA binding proteins, and serve as a substrate for enzymatic reactions.<ref>Svoboda, P., & Cara, A. (2006). Hairpin RNA: A secondary structure of primary importance. Cellular and Molecular Life Sciences, 63(7), 901-908.</ref>

Hairpin loops are often elements found within the 5'UTR of prokaryotes. These structures are often bound by proteins or cause the attenuation of a transcript in order to regulate translation.<ref name=Meyer>{{cite journal|last=Meyer|first=Michelle|author2=Deiorio-Haggar K |author3=Anthony J |title=RNA structures regulating ribosomal protein biosynthesis in bacilli|journal=RNA Biology|date=July 2013|volume=10|series=7|pages=1160–1164|doi=10.4161/rna.24151|pmid=23611891 }}</ref>

The mRNA stem-loop structure forming at the ribosome binding site may control an initiation of translation.<ref name=Malys2009>{{cite journal | author = Malys N, Nivinskas R | title = Non-canonical RNA arrangement in T4-even phages: accommodated ribosome binding site at the gene 26-25 intercistronic junction |journal = Mol Microbiol |volume = 73 | issue = 6 | pages = 1115–1127 | date = 2009 | pmid = 19708923 | doi =10.1111/j.1365-2958.2009.06840.x }}</ref><ref name=Malys2010>{{ cite journal | author = Malys N, McCarthy JEG | title = Translation initiation: variations in the mechanism can be anticipated |journal = Cellular and Molecular Life Sciences | date = 2010 | doi =10.1007/s00018-010-0588-z | pmid=21076851 | volume = 68 | issue = 6 | pages = 991–1003 }}</ref>
{{clear}}

====AUREs====
{{main|Adenylate–uridylate rich element gene transcriptions#Adenylate–uridylate rich element (Bakheet) samplings}}

====Adenylate–uridylate rich elements (Chen and Shyu, Class I)====
{{main|Adenylate–uridylate rich element gene transcriptions#ATTTA (Chen and Shyu, Class I) samplings}}

====Adenylate–uridylate rich elements (Chen and Shyu, Class II)====
{{main|Adenylate–uridylate rich element gene transcriptions#UUAUUUA(U/A)(U/A) (Chen and Shyu, Class II) samplings}}

====Adenylate–uridylate rich elements (Chen and Shyu, Class III)====
{{main|Adenylate–uridylate rich element gene transcriptions#ATTT (Chen and Shyu, Class III)}}

====MERs====
{{main|Adenylate–uridylate rich element gene transcriptions#Overlapping (Siegel) mers}}

====Constitutive decay elements====
{{main|Adenylate–uridylate rich element gene transcriptions#Constitutive decay element (Siegel) samplings}}

==={{chem|Cys|2|His|2}} SP / Kruppel-like factor (KLF) transcription factor family===

The {{chem|Cys|2|His|2}}-like fold group ({{chem|Cys|2|His|2}}) is by far the best-characterized class of zinc fingers, and is common in mammalian transcription factors, where such domains adopt a simple ββα fold and have the amino acid sequence motif:<ref name=Pabo2001>{{cite journal | author = Pabo CO, Peisach E, Grant RA | title = Design and selection of novel Cys2His2 zinc finger proteins | journal = Annual Review of Biochemistry | volume = 70 | pages = 313–40 | date = 2001 | pmid = 11395410 | doi = 10.1146/annurev.biochem.70.1.313 }}</ref>

:X<sub>2</sub>-Cys-X<sub>2,4</sub>-Cys-X<sub>12</sub>-His-X<sub>3,4,5</sub>-His

====Alcohol dehydrogenase repressor 1====
{{main|Adr1p gene transcriptions#ADR samplings}}

====SP1M1s====
{{main|Specificity protein gene transcriptions#Sp1-box 1 (Motojima) Samplings}}

====SP1M2s====
{{main|Specificity protein gene transcriptions#Sp1-box 2 (Motojima) Samplings}}

====SP-1 (Sato)s====
{{main|Specificity protein gene transcriptions#Sp-1 (Sato) samplings}}

====SP1 (Yao)s====
{{main|Specificity protein gene transcriptions#Sp1 (Yao) samplings}}

====YY1Ts====
{{main|YY1 gene transcriptions#YY1 CCATCTT samplings}}

===AP-2/EREBP-related factors===

====AGC boxes====
{{main|AGC box gene transcriptions#AGC box samplings}}

===AP-1 transcription factor network (Pathway)===

Sixty-nine genes are included in the AP-1 transcription factor network (Pathway).<ref name=AP-1TFN>{{ cite web
|author=NCBI
|title=AP-1 transcription factor network
|publisher=National Center for Biotechnology Information, U.S. National Library of Medicine
|location=8600 Rockville Pike, Bethesda MD, 20894 USA
|date=9 March 2021
|url=https://pubchem.ncbi.nlm.nih.gov/pathway/Pathway%20Interaction%20Database:ap1_pathway
|accessdate=26 October 2021 }}</ref>

====AGCEs====
{{main|AGCE gene transcriptions#AGCE samplings}}

===Zinc finger DNA-binding domains===

====AnRE1s====
{{main|Androgen response element gene transcriptions#Androgen response element1 (Kouhpayeh) samplings}}

====AnDRE2s====
{{main|Androgen response element gene transcriptions#Androgen response element2 (Kouhpayeh) samplings}}

====AnREWs====
{{main|Androgen response element gene transcriptions#Androgen response element (Wilson) samplings}}

====B-boxes====
{{main|B box gene transcriptions#B box (Johnson) samplings}}

====Box Bs====
{{main|B box gene transcriptions#B1 box (Sanchez) samplings}}

===β-Scaffold factors===

"Higher animals have [transcription factor] TF genes for the basic domain, the β-scaffold factor, and other new 
structures; however, their total proportion is less than 15% and most are [zinc (Zn)-coordinating factor] ZF and [Helix-Turn-Helix] HTH genes."<ref name=Nagata>{{ cite book
|author=Toshifumi Nagata, Aeni Hosaka-Sasaki and Shoshi Kikuchi
|title=The Evolutionary Diversification of Genes that Encode Transcription Factor Proteins in Plants, In: ''Plant Transcription Factors Evolutionary, Structural and Functional Aspects''
|publisher=Academic Press
|location=
|date=2016
|editor=Daniel H. Gonzalez
|pages=73-97
|url=https://www.sciencedirect.com/science/article/pii/B9780128008546000051
|arxiv=
|bibcode=
|doi=10.1016/B978-0-12-800854-6.00005-1
|pmid=
|isbn=978-0-12-800854-6
|accessdate=28 November 2021 }}</ref>

====ATA boxes====
{{main|ATA box gene transcriptions#ATA box samplings}}

====Γ-interferon activated sequences====
{{main|Γ-interferon activated sequence gene transcriptions#Γ-interferon activated sequence samplings}}

====HMG boxes====
{{main|HMG box gene transcriptions#HMG box samplings}}

===Zn(II)<sub>2</sub>Cys<sub>6</sub> proteins===

"The transcription factors Uga3, Dal81 and Leu3 belong to the class III family (Zn(II)<sub>2</sub>Cys<sub>6</sub> proteins), and they recognize highly related sequences rich in GGC triplets [15]."<ref name=Ruiz>{{ cite journal
|author=Marcos Palavecino-Ruiz, Mariana Bermudez-Moretti, Susana Correa-Garcia
|title=Unravelling the transcriptional regulation of Saccharomyces cerevisiae UGA genes: the dual role of transcription factor LEU3
|journal=Microbiology
|date=1 November 2017
|volume=
|issue=
|pages=
|url=https://www.researchgate.net/profile/Mariana_Bermudez3/publication/320571623_Unravelling_the_transcriptional_regulation_of_Saccharomyces_cerevisiae_UGA_genes_the_dual_role_of_transcription_factor_Leu3/links/5c62114c299bf1d14cbf7ade/Unravelling-the-transcriptional-regulation-of-Saccharomyces-cerevisiae-UGA-genes-the-dual-role-of-transcription-factor-Leu3.pdf
|arxiv=
|bibcode=
|doi=10.1099/mic.0.000560
|pmid=
|accessdate=21 February 2021 }}</ref>

====Dal81====

====GCC boxes====
{{main|AGC box gene transcriptions#GCC box samplings}}

====GGC triplets====
{{main|GGC triplet gene transcriptions#GGC samplings}}

=====GGCGGC triplets=====
{{main|GGC triplet gene transcriptions#GGCGGC triplet samplings}}

====Leu3====
{{main|Leu3 gene transcriptions#Leu samplings|GGC triplet gene transcriptions#Leu3 samplings}}

====Uga3====
{{main|Leu3 gene transcriptions}}

===Hairpin-hinge-hairpin-tail===

"In addition to this ACA box, they have the consensus H box sequence (5'-ANANNA-3') but have no other primary sequence identity. Despite this lack of primary sequence conservation, the H and ACA boxes are embedded in an evolutionarily conserved hairpin-hinge-hairpin-tail core secondary structure with the H box in the single-stranded hinge region and the ACA box in the single-stranded tail (5, 16)."<ref name=Mitchell>{{ cite journal
|author=James R. Mitchell, Jeffrey Cheng, ang Kathleen Collins
|title=A Box H/ACA Small Nucleolar RNA-Like Domain at the Human Telomerase RNA 3' End
|journal=Molecular and Cellular Biology
|date=January 1999
|volume=19
|issue=1
|pages=567–576
|url=http://mcb.asm.org/content/19/1/567.full.pdf
|arxiv=
|bibcode=
|doi=
|pmid=
|accessdate=5 November 2018 }}</ref>

====H and ACA boxes====
{{main|H and ACA box gene transcriptions#H and ACA boxes in promoters of A1BG}}

====H-boxes (Grandbastien)====
{{main|H box gene transcriptions#H-box (Grandbastien) samplings}}

====H-boxes (Lindsay)====
{{main|H box gene transcriptions#H-box (Lindsay) samplings}}

====H boxes (Mitchell)====
{{main|H box gene transcriptions#H boxes (Mitchell) samplings}}

====H boxes (Rozhdestvensky)====
{{main|H box gene transcriptions#H boxes (Rozhdestvensky) in promoters of A1BG}}

===Unknown response element types===

====ACEs====
{{main|MYB recognition element gene transcriptions#ACE samplings}}

====BBCABW Inrs====
{{main|Initiator element gene transcriptions#BBCABW samplings}}

====Calcineurin-responsive transcription factors====
{{main|Calcineurin-responsive transcription factor gene transcriptions#CRT samplings}}

====Carbs====
{{main|Carbohydrate response element gene transcriptions#ACCGG (Carb) samplings}}

====Carb1s====
{{main|Carbohydrate response element gene transcriptions#CCCAT (Carb1) samplings}}

====Cat8s====
{{main|Cat8p gene transcriptions#Cat8p samplings}}

====Cell-cycle box variants====
{{Main|Cell-cycle box gene transcriptions#CCB variant samplings}}

====CGCG boxes====
{{main|CGCG box gene transcriptions#CGCG box samplings}}

====Circadian control elements====
{{main|Circadian control element gene transcriptions#CCE samplings}}

====Cold-responsive elements====
{{main|Cold-responsive element gene transcriptions#Cold-responsive element samplings}}

====Copper response elements====
{{main|Copper response element gene transcriptions}}

=====CuREQs=====
{{main|Copper response element gene transcriptions#CuRE (Quinn) samplings}}

=====CuREPs=====
{{main|Copper response element gene transcriptions#CuRE (Park) samplings}}

====Cytoplasmic polyadenylation elements====
{{main|Cytoplasmic polyadenylation element gene transcriptions#CPE samplings}}

====DAF-16 binding elements====
{{main|DAF-16 binding element gene transcriptions#DBE samplings}}

====D box (Samarsky)====
{{main|D box gene transcriptions#Dbox (Samarsky) samplings}}

====D box (Voronina)====
{{main|D box gene transcriptions#D box (Voronina) samplings}}

====D-box (Motojima)====
{{main|D box gene transcriptions#(Motojima) samplings}}

====dBRE====
{{main|Downstream TFIIB recognition element gene transcriptions#dBRE samplings}}

====Downstream core elements====
{{main|Downstream core element gene transcriptions}}

====DCE SI====
{{main|Downstream core element gene transcriptions#Downstream core element SI samplings}}

====DCE SII====
{{main|Downstream core element gene transcriptions#Downstream core element SII samplings}}

====DCE SIII====
{{main|Downstream core element gene transcriptions#Downstream core element SIII samplings}}

====DPE (Juven-Gershon)====
{{main|Downstream promoter element gene transcriptions#DPE (Juven-Gershon) samplings}}

====DPE (Kadonaga)====
{{main|Downstream promoter element gene transcriptions#DPE (Kadonaga) samplings}}

====DPE (Matsumoto)====
{{main|Downstream promoter element gene transcriptions#DPE (Matsumoto) samplings}}

====EIN3 binding sites====
{{main|EIN3 binding site gene transcriptions#EIN3 samplings}}

====Endosperm expressions====
{{main|Endosperm expression gene transcriptions#Endosperm expression samplings}}

====Estrogen response elements====
{{main|Estrogen response element gene transcriptions}}

=====ERE1s=====
{{main|Estrogen response element gene transcriptions#ERE1 (Driscoll) samplings}}

=====ERE2s=====
{{main|Estrogen response element gene transcriptions#EREs (Driscoll) samplings}}

====GAAC elements====
{{main|GAAC element gene transcriptions#GAAC element samplings}}

====GC boxes (Briggs)====
{{main|GC box gene transcriptions#GC box (Briggs) samplings}}

====GC boxes (Ye)====
{{main|GC box gene transcriptions#GC box (Ye) samplings}}

====GC boxes (Zhang)====
{{main|GC box gene transcriptions#GC box (Zhang) samplings}}

====GCR1s====
{{main|Gcr1p gene transcriptions#GCR1 samplings}}

====GREs====
{{main|Gibberellin responsive element gene transcriptions#GRE samplings}}

====GT boxes (Sato)====
{{main|TC element gene transcriptions#GT box (Sato) samplings}}

====Hex sequences====
{{main|Hex sequence gene transcriptions#Hex core samplings}}

====HY boxes====
{{main|HY box gene transcriptions#HY box samplings}}

====IFNs====
{{main|Interferon regulatory factor gene transcriptions#IFN-stimulated response element samplings}}

====Inr-like, TCTs====
{{main|Initiator element gene transcriptions#Inr-like, TCTs sampling}}

====IRF3s====
{{main|Interferon regulatory factor gene transcriptions#IRF-3 samplings}}

====IRSs====
{{main|Interferon regulatory factor gene transcriptions#IRS consensus samplings}}

====KAR2s====
{{main|Hac1p gene transcriptions#KAR2 samplings}}

====MBE1s====
{{main|Musashi binding element gene transcriptions#MBE1 samplings}}

====MBE2s====
{{main|Musashi binding element gene transcriptions#MBE2 samplings}}

====MBE3s====
{{main|Musashi binding element gene transcriptions#MBE3 samplings}}

====NF𝜿BSs====
{{main|Nuclear factor gene transcriptions#NF𝜿B (Sato) samplings}}

====PREs====
{{main|Polycomb response element gene transcriptions#Core samplings}}

====Pribs====
{{main|Pribnow box gene transcriptions#Pribnow box samplings}}

====RAREs====
{{main|Retinoic acid response element gene transcriptions#RARE samplings}}

====Rgts====
{{main|Rgt1p gene transcriptions#RGT samplings}}

====ROREs====
{{main|ROR-response element gene transcriptions#RORE samplings}}

====SERVs====
{{main|Servenius sequence gene transcriptions#Servenius samplings}}

====STAT5s====
{{main|STAT5 gene transcription laboratory#STAT5 samplings}}

====STREs====
{{main|Msn2,4p gene transcriptions#Stress-response element samplings}}

====Sucroses====
{{main|Sucrose box gene transcriptions#Sucrose box samplings}}

====TACTs====
{{main|TACTAAC box gene transcriptions#TACT samplings}}

====TAGteams====
{{main|TAGteam gene transcriptions#TAGteam samplings}}

====TAPs====
{{main|Tapetum box gene transcriptions#Tapetum box samplings}}

====TATAs====
{{main|TATA box gene transcriptions#TATA box samplings}}
Examining the promoter regions upstream from ZSCAN22 to A1BG and downstream from ZNF497 to A1BG for TATA boxes has shown that TATA boxes in various forms are present and likely active or activable: (1) TATAAAA (Carninci 2006), (2) TATA(A/T)A(A/T) (Watson 2014), (3) TATA(A/T)AA(A/G) (Juven-Gershon 2010), and (4) TATA(A/T)A(A/T)(A/G) (Basehoar 2004).

The TATA boxes have the pattern of appearing in only the negative direction UTRs, proximal and distals. The shorter TATA box: TATAAA does appear as above but also in the positive direction as the complement inverse TTTATA at 2588 in the distal promoter.

====TATABs====
{{main|TATA box gene transcriptions#TATA box (Butler 2002) samplings}}

====TATACs====
{{main|TATA box gene transcriptions#TATA boxes (Carninci 2006) samplings}}

====TATAJs====
{{main|TATA box gene transcriptions#TATA box (Juven-Gershon 2010) samplings}}

====TATAWs====
{{main|TATA box gene transcriptions#TATA box (Watson 2014) samplings}}

====TEAs====
{{main|TEA consensus sequence gene transcriptions#TEA samplings}}

====TECs====
{{main|Tec1p gene transcriptions#Tec1 samplings}}

====THRs====
{{main|Thyroid hormone response element gene transcriptions#THR samplings}}

====TRFs====
{{main|Telomeric repeat DNA-binding factor gene transcriptions#TRF samplings}}

====UPREs====
{{main|Unfolded protein response element gene transcriptions#UPRE samplings}}

====UPRE-1s====
{{main|Hac1p gene transcriptions#UPRE-1 samplings}}

====URS (Sumrada, core)====
{{main|DNA damage response element gene transcriptions#URS1 (Sumrada, core) samplings}}

====VDREs====
{{main|Vitamin D response element gene transcriptions#VDRE samplings}}

====XCPE1s====
{{main|X core promoter element gene transcriptions#XCPE1 samplings}}

====Yaps====
{{main|Yap1p,2p gene transcriptions#Yap samplings}}

====YYRNWYY Inrs====
{{main|Initiator element gene transcriptions#YYRNWYY samplings}}

==A1BG orthologs==

===''Geotrypetes seraphini''===
[[Image:Geotrypetes seraphini 81151944.jpg|thumb|right|250px|''Geotrypetes seraphini'', the Gaboon caecilian, is a species of amphibian. Credit: [https://www.inaturalist.org/users/7865 Marius Burger].{{tlx|free media}}]]
''Geotrypetes seraphini'', the Gaboon caecilian, is a species of amphibian in the family ''Dermophiidae''.<ref name=IUCN>{{cite journal |author=IUCN SSC Amphibian Specialist Group |date=2019 |title=''Geotrypetes seraphini'' |volume=2019 |page=e.T59557A16957715 |url=https://en.wikipedia.org/wiki/IUCN_Red_List
|doi=10.2305/IUCN.UK.2019-1.RLTS.T59557A16957715.en |accessdate=16 November 2021}}</ref>

Its A1BG ortholog has 368 aa vs 495 aa for ''Homo sapiens''.
{{clear}}

==ZSCAN22==
{{main|ZSCAN22}}
# Gene ID: 342945 is ZSCAN22 zinc finger and SCAN domain containing 22 on 19q13.43.<ref name=HGNC342945>{{ cite web
|author=HGNC
|title=ZSCAN22 zinc finger and SCAN domain containing 22 [ Homo sapiens (human) ]
|publisher=National Center for Biotechnology Information
|location=U.S. National Library of Medicine, 8600 Rockville Pike, Bethesda MD, 20894 USA
|date=13 March 2020
|url=https://www.ncbi.nlm.nih.gov/gene/342945
|accessdate=2019-12-18 }}</ref> ZSCAN22 is transcribed in the negative direction from LOC100887072.<ref name=HGNC342945/>
# Gene ID: 102465484 is MIR6806 microRNA 6806 on 19q13.43: "microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop."<ref name=RefSeq102465484>{{ cite web
|author=RefSeq
|title=MIR6806 microRNA 6806 [ Homo sapiens (human) ]
|publisher=National Center for Biotechnology Information
|location=U.S. National Library of Medicine, 8600 Rockville Pike, Bethesda MD, 20894 USA
|date=10 September 2009
|url=https://www.ncbi.nlm.nih.gov/gene/102465484
|accessdate=2019-12-18 }}</ref> MIR6806 is transcribed in the negative direction from LOC105372480.<ref name=RefSeq102465484/>

Of the some 111 gaps between genes on chromosome locus 19q13.43 as of 4 August 2020, gap number 88 is between ZSCAN22 and A1BG. But, there is no gap between ZNF497 and A1BG.

==Promoters==

The core promoter begins approximately -35 nts upstream from the transcription start site (TSS). For the numbered nucleotides between ZSCAN22 and A1BG the core promoter extends from 4425 nts up to 4460 nts (TSS). The proximal promoter extends from approximately -250 to the TSS or 4210 nts up to 4460 nts. The distal promoter begins at about 2460 nts and extends to about 4210 nts.

From the ZNF497 side the core promoter begins about 4265 nts up to 4300 nts, the proximal promoter from 4050 nts to 4265 nts, and the distal promoter from 2300 nts to 4050 nts.

==Alpha-1-B glycoprotein==
{{main|Alpha-1-B glycoprotein}}
'''Def.''' "a substance that induces an immune response, usually foreign"<ref name=AntigenWikt>{{ cite web
|author=[[wikt:User:Jag123|Jag123]]
|title=antigen
|publisher=Wikimedia Foundation, Inc
|location=San Francisco, California
|date=7 March 2005
|url=https://en.wiktionary.org/wiki/antigen
|accessdate=7 March 2020 }}</ref> is called an '''antigen'''.

'''Def.''' any "substance that elicits [an] immune response"<ref name=ImmunogenWikt>{{ cite web
|author=[[wikt:User:SemperBlotto|SemperBlotto]]
|title=immunogen
|publisher=Wikimedia Foundation, Inc
|location=San Francisco, California
|date=21 April 2008
|url=https://en.wiktionary.org/wiki/immunogen
|accessdate=8 March 2020 }}</ref> is called an '''immunogen'''.

An antigen "or immunogen is a molecule that sometimes stimulates an immune system response."<ref name=AntigenWikidoc>{{ cite web
|author=C. Michael Gibson
|title=Antigen
|publisher=WikiDoc Foundation
|location=Boston, Massachusetts
|date=27 April 2008
|url=https://www.wikidoc.org/index.php/Antigen
|accessdate=8 March 2020 }}</ref> But, "the immune system does not consist of only antibodies",<ref name=AntigenWikidoc/> instead it "encompasses all substances that can be recognized by the [[adaptive immune system]]."<ref name=AntigenWikidoc/>

'''Def.''' "a protein produced by B-lymphocytes that binds to [a specific antigen or]<ref name=AntibodyWikt1>{{ cite web
|author=[[wikt:User:Williamsayers79|Williamsayers79]]
|title=antibody
|publisher=Wikimedia Foundation, Inc
|location=San Francisco, California
|date=26 February 2007
|url=https://en.wiktionary.org/wiki/antibody
|accessdate=7 March 2020 }}</ref> an antigen"<ref name=AntibodyWikt>{{ cite web
|author=[[wikt:User:Jag123|Jag123]]
|title=antibody
|publisher=Wikimedia Foundation, Inc
|location=San Francisco, California
|date=7 March 2005
|url=https://en.wiktionary.org/wiki/antibody
|accessdate=7 March 2020 }}</ref> is called an '''[[antibody]]'''.

Five different antibody isotypes are known in mammals, which perform different roles, and help direct the appropriate immune response for each different type of foreign object they encounter.<ref name=Market>{{ cite journal
|author=Eleonora Market, F. Nina Papavasiliou
|date=2003
|url=http://biology.plosjournals.org/perlserv/?request=get-document&doi=10.1371/journal.pbio.0000016
|title=V(D)J Recombination and the Evolution of the Adaptive Immune System
|journal=PLoS Biology
|volume=1
|issue=1
|pages=e16
|doi=10.1371/journal.pbio.0000016 }}</ref>

Although the general structure of all antibodies is very similar, a small region, known as the hypervariable region, at the tip of the protein is extremely variable, allowing millions of antibodies with slightly different tip structures to exist, where each of these variants can bind to a different target, known as an antigen.<ref name=Janeway5>{{ cite book | author = Charles A Janeway, Jr, Paul Travers, Mark Walport, and Mark J Shlomchik | title = Immunobiolog. | edition = 5th ed. | publisher = Garland Publishing | date = 2001 | url = http://www.ncbi.nlm.nih.gov/books/bv.fcgi?call=bv.View..ShowTOC&rid=imm.TOC&depth=10 | isbn = 0-8153-3642-X }}</ref>

'''Def.''' "any of the glycoproteins in blood serum that respond to invasion by foreign antigens and that protect the host by removing pathogens;"<ref name=ImmunoglobulinWikt>{{ cite web
|author=[[wikt:User:SemperBlotto|SemperBlotto]]
|title= immunoglobulin
|publisher=Wikimedia Foundation, Inc
|location=San Francisco, California
|date=25 February 2006
|url=https://en.wiktionary.org/wiki/immunoglobulin
|accessdate=7 March 2020 }}</ref> "an antibody"<ref name=ImmunoglobulinWikt1>{{ cite web
|author=[[wikt:User:SemperBlotto|SemperBlotto]]
|title= immunoglobulin
|publisher=Wikimedia Foundation, Inc
|location=San Francisco, California
|date=28 April 2008
|url=https://en.wiktionary.org/wiki/immunoglobulin
|accessdate=7 March 2020 }}</ref> is called an '''[[immunoglobulin]]'''.

Gene ID: 1 is A1BG [[alpha-1-B glycoprotein]] on 19q13.43, a 54.3 kDa [[protein]] in humans that is encoded by the A1BG [[gene]].<ref name=RefSeq1>{{ cite web
|author=RefSeq
|title=A1BG alpha-1-B glycoprotein [ Homo sapiens (human) ]
|publisher=National Center for Biotechnology Information
|location=U.S. National Library of Medicine, 8600 Rockville Pike, Bethesda MD, 20894 USA
|date=10 December 2019
|url=https://www.ncbi.nlm.nih.gov/gene/1
|accessdate=2019-12-18 }}</ref> A1BG is transcribed in the positive direction from ZNF497.<ref name=RefSeq1/> "The protein encoded by this gene is a plasma glycoprotein of unknown function. The protein shows sequence similarity to the variable regions of some immunoglobulin supergene family member proteins."<ref name=RefSeq1/>
# NP_570602.2  alpha-1B-glycoprotein precursor, '''cd05751''' Location: 401 → 493 Ig1_LILRB1_like; First immunoglobulin (Ig)-like domain found in Leukocyte Ig-like receptors (LILR)B1 (also known as LIR-1) and similar proteins, '''smart00410''' Location: 218 → 280 IG_like; Immunoglobulin like, '''pfam13895''' Location: 210 → 301 Ig_2; Immunoglobulin domain and '''cl11960''' Location: 28 → 110 Ig; Immunoglobulin domain.<ref name=RefSeq1/>

Patients who have pancreatic ductal [[adenocarcinoma]] show an [[overexpression]] of A1BG in [[pancreatic juice]].<ref name=Tian>{{ cite journal
|author=Mei Tian, Ya-Zhou Cui, Guan-Hua Song, Mei-Juan Zong, Xiao-Yan Zhou, Yu Chen, Jin-Xiang Han
| title = Proteomic analysis identifies MMP-9, DJ-1 and A1BG as overexpressed proteins in pancreatic juice from pancreatic ductal adenocarcinoma patients
| journal = BMC Cancer
| volume = 8
| issue =
| pages = 241
| date = 2008
| pmid = 18706098
| pmc = 2528014
| doi = 10.1186/1471-2407-8-241
|url=https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2528014/ }}</ref>

===Immunoglobulin supergene family===
{{main|Immunoglobulin supergene family}}
"𝛂<sub>1</sub>B-glycoprotein(𝛂<sub>1</sub>B) [...] consists of a single polypeptide chain N-linked to four
glucosamine oligosaccharides. The polypeptide has five intrachain disulfide bonds and contains 474 amino acid residues. [...] 𝛂<sub>1</sub>B exhibits internal duplication and consists of five repeating structural domains, each containing about 95 amino acids and one disulfide bond. [...] several domains of 𝛂<sub>1</sub>B, especially the third, show statistically significant homology to variable regions of certain immunoglobulin light and heavy chains. 𝛂<sub>1</sub>B [...] exhibits sequence similarity to other members of the [[immunoglobulin supergene family]] such as the receptor for transepithelial transport of IgA and IgM and the secretory component of human IgA."<ref name=Ishioka/>

"Some of the domains of 𝛂<sub>1</sub>B show significant homology to variable (V) and constant (C) regions of certain immunoglobulins. Likewise, there is statistically significant homology between 𝛂<sub>1</sub>B and the secretory component (SC) of human IgA (15) and also with the extracellular portion of the rabbit receptor for transepithelial transport of polymeric immunoglobulins (IgA and IgM). Mostov et al. (16) have called the later protein the poly-Ig receptor or poly-IgR and have shown that it is the precursor of SC."<ref name=Ishioka/>

The immunoglobulin supergene family is "the group of proteins that have immunoglobulin-like domains, including histocompatibility antigens, the T-cell antigen receptor, poly-IgR, and other proteins involved in the vertebrate immune response (17)."<ref name=Ishioka/>

"The internal homology in primary structure [...] and the presence of an intrasegment disulfide bond suggest that 𝛂<sub>1</sub>B is composed of five structural domains that arose by duplication of a primordial gene coding for about 95 amino acid residues."<ref name=Ishioka/>

"Unlike immunoglobulins (25), ceruloplasmin (6), and hemopexin (7), 𝛂<sub>1</sub>B is not subject to limited interdomain cleavage by proteolytic enzymes. At least, we were not able to produce such fragments by use of a variety of proteases. This stability of 𝛂<sub>1</sub>B is probably associated with the frequency of proline in the sequences linking the domains [...]."<ref name=Ishioka/>

"A peptide identified in the late and early milk proteomes showed homology to eutherian alpha 1B glycoprotein (A1BG), a plasma protein with unknown function<sup>46</sup>, as well as venom inhibitors characterised in the Southern opossum ''Didelphis marsupialis'' (DM43 and DM46<sup>47,48,49</sup>), all members of the immunoglobulin superfamily. To characterise the relationship between the peptide sequence identified in koala, A1BG, DM43 and DM46, a phylogenetic tree was constructed [...] including all marsupial and monotreme homologs (identified by BLAST), three phylogenetically representative eutherian sequences, with human IGSF1 and TARM1, related members of the immunoglobulin super family, used as outgroups. This phylogeny indicates that A1BG-like proteins in marsupials and the ''Didelphis'' antitoxic proteins are homologs of eutherian A1BG, with excellent bootstrap support (98%). The marsupial A1BG-like sequences and the ''Didelphis'' antitoxic proteins formed a single clade with strong bootstrap support (97%)."<ref name=Morris>{{ cite journal
|author=Katrina M. Morris, Denis O’Meally, Thiri Zaw, Xiaomin Song, Amber Gillett, Mark P. Molloy, Adam Polkinghorne, and Katherine Belova
|title=Characterisation of the immune compounds in koala milk using a combined transcriptomic and proteomic approach
|journal=Scientific Reports
|date=7 October 2016
|volume=6
|issue=
|pages=35011
|url=https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5054531/
|arxiv=
|bibcode=
|doi=10.1038/srep35011
|pmid=27713568
|accessdate=14 March 2020 }}</ref>

"Human TARM1 and IGSF1, related members of the immunoglobulin superfamily are used as outgroups. The tree was constructed using the maximum likelihood approach and the JTT model with bootstrap support values from 500 bootstrap tests. Bootstrap values less than 50% are not displayed. Accession numbers: Tasmanian devil (''Sarcophilus harrisii''; XP_012402143), Wallaby (''Macropus eugenii''; FY619507), Possum (''Trichosurus vulpecula''; DY596639) Virginia opossum (''Didelphis virginiana''; AAA30970, AAN06914), Southern opossum (''Didelphis marsupialis''; AAL82794, P82957, AAN64698), Human (''Homo sapiens''; P04217, B6A8C7, Q8N6C5), Platypus (''Ornithorhychus anatinus''; ENSOANP00000000762), Cow (''Bos taurus''; Q2KJF1), Alpaca (''Vicugna pacos''; XP_015107031)."<ref name=Morris/>

"The sequences of 𝛂<sub>1</sub>B-glycoprotein (38) and chicken N-CAM (neural cell-adhesion molecule) (39) have been shown to be related to the immunoglobulin supergene family."<ref name=Paxton>{{ cite journal
|author=R. J. Paxton, G. Mooser, H. Pande, T. D. Lee, and J. E. Shively
|title=Sequence analysis of carcinoembryonic antigen: identification of glycosylation sites and homology with the immunoglobulin supergene family
|journal=Proceedings of the National Academy of Sciences USA
|date=1 February 1987
|volume=84
|issue=4
|pages=920-924
|url=https://www.pnas.org/content/pnas/84/4/920.full.pdf
|arxiv=
|bibcode=
|doi=10.1073/pnas.84.4.920
|pmid=3469650
|accessdate=26 March 2020 }}</ref>

A1BG contains the immunoglobulin domain: '''cl11960''' and three immunoglobulin-like domains: '''pfam13895''', '''cd05751''' and '''smart00410'''.

"Immunoglobulin (Ig) domain ['''cl11960'''] found in the Ig superfamily. The Ig superfamily is a heterogenous group of proteins, built on a common fold comprised of a sandwich of two beta sheets. Members of this group are components of immunoglobulin, neuroglia, cell surface glycoproteins, such as, T-cell receptors, CD2, CD4, CD8, and membrane glycoproteins, such as, butyrophilin and chondroitin sulfate proteoglycan core protein. A predominant feature of most Ig domains is a disulfide bridge connecting the two beta-sheets with a tryptophan residue packed against the disulfide bond."<ref name=NCBI386229>{{ cite web
|author=NCBI
|title=Conserved Protein Domain Family cl11960: Ig Superfamily
|publisher=National Center for Biotechnology Information, U.S. National Library of Medicine
|location=8600 Rockville Pike, Bethesda MD, 20894 USA
|date=2 February 2016
|url=https://www.ncbi.nlm.nih.gov/Structure/cdd/cddsrv.cgi?uid=386229
|accessdate=22 May 2020 }}</ref>

"This domain ['''pfam13895'''] contains immunoglobulin-like domains."<ref name=NCBI372793>{{ cite web
|author=NCBI
|title=Conserved Protein Domain Family pfam13895: Ig_2
|publisher=National Center for Biotechnology Information, U.S. National Library of Medicine
|location=8600 Rockville Pike, Bethesda MD, 20894 USA
|date=5 August 2015
|url=https://www.ncbi.nlm.nih.gov/Structure/cdd/cddsrv.cgi?uid=372793
|accessdate=24 May 2020 }}</ref>

"Ig1_LILR_KIR_like: ['''cd05751'''] domain similar to the first immunoglobulin (Ig)-like domain found in Leukocyte Ig-like receptors (LILRs) and Natural killer inhibitory receptors (KIRs). This group includes LILRB1 (or LIR-1), LILRA5 (or LIR9), an activating natural cytotoxicity receptor NKp46, the immune-type receptor glycoprotein VI (GPVI), and the IgA-specific receptor Fc-alphaRI (or CD89). LILRs are a family of immunoreceptors expressed on expressed on T and B cells, on monocytes, dendritic cells, and subgroups of natural killer (NK) cells. The human LILR family contains nine proteins (LILRA1-3,and 5, and LILRB1-5). From functional assays, and as the cytoplasmic domains of various LILRs, for example LILRB1 (LIR-1), LILRB2 (LIR-2), and LILRB3 (LIR-3) contain immunoreceptor tyrosine-based inhibitory motifs (ITIMs) it is thought that LIR proteins are inhibitory receptors. Of the eight LIR family proteins, only LIR-1 (LILRB1), and LIR-2 (LILRB2), show detectable binding to class I MHC molecules; ligands for the other members have yet to be determined. The extracellular portions of the different LIR proteins contain different numbers of Ig-like domains for example, four in the case of LILRB1 (LIR-1), and LILRB2 (LIR-2), and two in the case of LILRB4 (LIR-5). The activating natural cytotoxicity receptor NKp46 is expressed in natural killer cells, and is organized as an extracellular portion having two Ig-like extracellular domains, a transmembrane domain, and a small cytoplasmic portion. GPVI, which also contains two Ig-like domains, participates in the processes of collagen-mediated platelet activation and arterial thrombus formation. Fc-alphaRI is expressed on monocytes, eosinophils, neutrophils and macrophages; it mediates IgA-induced immune effector responses such as phagocytosis, antibody-dependent cell-mediated cytotoxicity and respiratory burst."<ref name=NCBI319306>{{ cite web
|author=NCBI
|title=Conserved Protein Domain Family cd05751: Ig1_LILR_KIR_like
|publisher=National Center for Biotechnology Information, U.S. National Library of Medicine
|location=8600 Rockville Pike, Bethesda MD, 20894 USA
|date=16 August 2016
|url=https://www.ncbi.nlm.nih.gov/Structure/cdd/cddsrv.cgi?uid=319306
|accessdate=24 May 2020 }}</ref>

"IG domains ['''smart00410'''] that cannot be classified into one of IGv1, IGc1, IGc2, IG."<ref name=NCBI214653>{{ cite web
|author=NCBI
|title=Conserved Protein Domain Family smart00410: IG_like
|publisher=National Center for Biotechnology Information, U.S. National Library of Medicine
|location=8600 Rockville Pike, Bethesda MD, 20894 USA
|date=16 January 2013
|url=https://www.ncbi.nlm.nih.gov/Structure/cdd/cddsrv.cgi?uid=214653
|accessdate=24 May 2020 }}</ref>
"𝛂<sub>1</sub>B-glycoprotein(𝛂<sub>1</sub>B) [...] consists of a single polypeptide chain N-linked to four
glucosamine oligosaccharides. The polypeptide has five intrachain disulfide bonds and contains 474 amino acid residues. [...] 𝛂<sub>1</sub>B exhibits internal duplication and consists of five repeating structural domains, each containing about 95 amino acids and one disulfide bond. [...] several domains of 𝛂<sub>1</sub>B, especially the third, show statistically significant homology to variable regions of certain immunoglobulin light and heavy chains. 𝛂<sub>1</sub>B [...] exhibits sequence similarity to other members of the immunoglobulin supergene family such as the receptor for transepithelial transport of IgA and IgM and the secretory component of human IgA."<ref name=Ishioka>{{ cite journal
|author=Noriaki Ishioka, Nobuhiro Takahashi, and Frank W. Putnam
|title=Amino acid sequence of human plasma 𝛂<sub>1</sub>B-glycoprotein: Homology to the immunoglobulin supergene family
|journal=Proceedings of the National Academy of Sciences USA
|date=April 1986
|volume=83
|issue=8
|pages=2363-7
|url=https://www.ncbi.nlm.nih.gov/pmc/articles/PMC323297/pdf/pnas00312-0089.pdf
|arxiv=
|bibcode=
|doi=10.1073/pnas.83.8.2363
|pmid=3458201
|accessdate=9 March 2020 }}</ref>

===A1BG protein species===

'''Def.''' a "group of plants or animals having similar appearance"<ref name=SpeciesWikt>{{ cite web
|author=[[wikt:User:24.98.118.180|24.98.118.180]]
|title=species
|publisher=Wikimedia Foundation, Inc
|location=San Francisco, California
|date=28 February 2007
|url=https://en.wiktionary.org/wiki/species
|accessdate=25 March 2020 }}</ref> or "the largest group of organisms in which [any]<ref name=Species1/> two individuals [of the appropriate sexes or mating types]<ref name=Species1>{{ cite web
|author=[[w:User:Peter coxhead|Peter coxhead]]
|title=Species
|publisher=Wikimedia Foundation, Inc
|location=San Francisco, California
|date=22 August 2018
|url=https://en.wikipedia.org/wiki/Species
|accessdate=25 March 2020 }}</ref> can produce fertile offspring, typically by sexual reproduction"<ref name=Species>{{ cite web
|author=[[w:User:Chiswick Chap|Chiswick Chap]]
|title=Species
|publisher=Wikimedia Foundation, Inc
|location=San Francisco, California
|date=1 December 2016
|url=https://en.wikipedia.org/wiki/Species
|accessdate=25 March 2020 }}</ref> is called a '''species'''.

The gene contains 20 distinct introns.<ref name=AceView>{{ cite web
|title=AceView: A1BG
|url=https://www.ncbi.nlm.nih.gov/IEB/Research/Acembly/av.cgi?db=human&term=a1bg&submit=Go
|accessdate=May 11, 2013 }}</ref> Transcription produces 15 different mRNAs, 10 alternatively spliced variants and 5 unspliced forms.<ref name="AceView"/> There are 4 probable alternative promoters, 4 non overlapping alternative last exons and 7 validated alternative polyadenylation sites.<ref name="AceView"/> The mRNAs appear to differ by truncation of the 5' end, truncation of the 3' end, presence or absence of 4 cassette exons, overlapping exons with different boundaries, splicing versus retention of 3 introns.<ref name="AceView"/>

====Variants or isoforms====

'''Def.''' a "different sequence of a gene (locus)"<ref name=VariantWikt>{{ cite web
|author=[[wikt:User:Pdeitiker|Pdeitiker]]
|title=variant
|publisher=Wikimedia Foundation, Inc
|location=San Francisco, California
|date=26 July 2008
|url=https://en.wiktionary.org/wiki/variant
|accessdate=25 March 2020 }}</ref> is called a '''variant'''.

'''Def.''' any "of several different forms of the same protein, arising from either single nucleotide polymorphisms,<ref name=IsoformWikt1>{{ cite web
|author=[[wikt:User:SemperBlotto|SemperBlotto]]
|title=isoform
|publisher=Wikimedia Foundation, Inc
|location=San Francisco, California
|date=6 January 2007
|url=https://en.wiktionary.org/wiki/isoform
|accessdate=2 December 2018 }}</ref> differential splicing of mRNA, or post-translational modifications (e.g. sulfation, glycosylation, etc.)"<ref name=IsoformWikt2>{{ cite web
|author=[[wikt:User:72.178.245.181|72.178.245.181]]
|title=isoform
|publisher=Wikimedia Foundation, Inc
|location=San Francisco, California
|date=30 November 2008
|url=https://en.wiktionary.org/wiki/isoform
|accessdate=2 December 2018 }}</ref> is called an '''isoform'''.

Regarding additional isoforms, mention has been made of "new genetic variants of A1BG."<ref name=Eiberg>{{ cite journal
|author=H Eiberg, ML Bisgaard, J Mohr
|title=Linkage between alpha 1B-glycoprotein (A1BG) and Lutheran (LU) red blood group system: assignment to chromosome 19: new genetic variants of A1BG
|journal=Clinical genetics
|date=1 December 1989
|volume=36
|issue=6
|pages=415-8
|url=http://europepmc.org/abstract/MED/2591067
|arxiv=
|bibcode=
|doi=
|pmid=2591067
|accessdate=2017-10-08 }}</ref>

"Proteomic analysis revealed that [a circulating] set of plasma proteins was α 1 B-glycoprotein ('''A1BG''') and its
post-translationally modified isoforms."<ref name=Stehle>{{ cite journal
|author=John R. Stehle Jr., Mark E. Weeks, Kai Lin, Mark C. Willingham, Amy M. Hicks, John F. Timms, Zheng Cui
|title=Mass spectrometry identification of circulating alpha-1-B glycoprotein, increased in aged female C57BL/6 mice
|journal=Biochimica et Biophysica Acta (BBA) - General Subjects
|date=January 2007
|volume=1770
|issue=1
|pages=79-86
|url=http://www.sciencedirect.com/science/article/pii/S0304416506001826
|arxiv=
|bibcode=
|doi=10.1016/j.bbagen.2006.06.020
|pmid=16945486
|accessdate=2017-10-08 }}</ref>

Pharmacogenomic variants have been reported.<ref name=McDonough/>

====Genotypes====

'''Def.''' the "part (DNA sequence) of the genetic makeup of an organism which determines a specific characteristic (phenotype) of that organism"<ref name=GenotypeWikt1>{{ cite web
|author=[[wikt:User:DTLHS|DTLHS]]
|title=genotype
|publisher=Wikimedia Foundation, Inc
|location=San Francisco, California
|date=10 January 2018
|url=https://en.wiktionary.org/wiki/genotype
|accessdate=25 March 2020 }}</ref> or a "group of organisms having the same genetic constitution" <ref name=GenotypeWikt>{{ cite web
|author=[[wikt:User:SemperBlotto|SemperBlotto]]
|title=genotype
|publisher=Wikimedia Foundation, Inc
|location=San Francisco, California
|date=22 October 2005
|url=https://en.wiktionary.org/wiki/genotype
|accessdate=25 March 2020 }}</ref>is called a '''genotype'''.

There are A1BG genotypes.<ref name=McDonough>{{ cite journal
|author=Caitrin W. McDonough, Yan Gong, Sandosh Padmanabhan, Ben Burkley, Taimour Y. Langaee, Olle Melander, Carl J. Pepine, Anna F. Dominiczak, Rhonda M. Cooper-DeHoff, and Julie A. Johnson
|title=Pharmacogenomic Association of Nonsynonymous SNPs in ''SIGLEC12'', ''A1BG'', and the Selectin Region and Cardiovascular Outcomes
|journal=Hypertension
|date=June 2013
|volume=62
|issue=1
|pages=48-54
|url=http://hyper.ahajournals.org/content/hypertensionaha/early/2013/05/20/HYPERTENSIONAHA.111.00823.full.pdf
|arxiv=
|bibcode=
|doi=10.1161/HYPERTENSIONAHA.111.00823
|pmid=23690342
|accessdate=2017-10-08 }}</ref>

A1BG has a genetic risk score of rs893184.<ref name=McDonough/>

"A genetic risk score, including rs16982743, rs893184, and rs4525 in F5, was significantly associated with treatment-related adverse cardiovascular outcomes in whites and Hispanics from the INVEST study and in the Nordic Diltiazem study (meta-analysis interaction P=2.39×10<sup>−5</sup>)."<ref name=McDonough/>

====Polymorphs====

'''Def.''' the "regular existence of two or more different genotypes within a given species or population; also, variability of amino acid sequences within a gene's protein"<ref name=PolymorphismWikt>{{ cite web
|author=[[wikt:User:Widsith|Widsith]]
|title=polymorphism
|publisher=Wikimedia Foundation, Inc
|location=San Francisco, California
|date=28 March 2012
|url=https://en.wiktionary.org/wiki/polymorphism
|accessdate=25 March 2020 }}</ref> is called '''polymorphism'''.

'''Def.''' "one of a number of alternative forms of the same gene occupying a given position, [or locus],<ref name=AlleleWikt1>{{ cite web
|author=[[wikt:User:217.105.66.98|217.105.66.98]]
|title=allele
|publisher=Wikimedia Foundation, Inc
|location=San Francisco, California
|date=8 September 2016
|url=https://en.wiktionary.org/wiki/allele
|accessdate=25 March 2020 }}</ref> on a chromosome"<ref name=AlleleWikt>{{ cite web
|author=[[wikt:User:138.130.33.215|138.130.33.215]]
|title=allele
|publisher=Wikimedia Foundation, Inc
|location=San Francisco, California
|date=7 April 2004
|url=https://en.wiktionary.org/wiki/allele
|accessdate=25 March 2020 }}</ref> is called an '''allele'''.

"rs893184 causes a histidine (His) to arginine (Arg) [nonsynonymous single nucleotide polymorphism (nsSNP), A (minor) for G (major)] substitution at amino acid position 52 in A1BG."<ref name=McDonough/>

"Genetic polymorphism of human plasma (serum) alpha 1B-glycoprotein (alpha 1B) was observed using one-dimensional horizontal polyacrylamide gel electrophoresis (PAGE) pH 9.0 of plasma samples followed by Western blotting with specific antiserum to alpha 1B."<ref name=Gahne>{{ cite journal
|author=B. Gahne, R. K. Juneja, and A. Stratil
|title=Genetic polymorphism of human plasma alpha 1B-glycoprotein: phenotyping by immunoblotting or by a simple method of 2-D electrophoresis
|journal=Human Genetics
|date=June 1987
|volume=76
|issue=2
|pages=111-5
|url=https://link.springer.com/article/10.1007%2FBF00284904
|arxiv=
|bibcode=
|doi=10.1007/bf00284904
|pmid=3610142
|accessdate=25 March 2020 }}</ref>

''A1B*5'' is a "new allele [...] of human plasma 𝜶<sub>1</sub>B-glycoprotein [...]."<ref name=Juneja1989>{{ cite journal
|author=R.K. Juneja, G. Beckman, M. Lukka, B. Gahne, and C. Ehnholm
|title=Plasma α<sub>1</sub>B-Glycoprotein Allele Frequencies in Finns and Swedish Lapps: Evidence for a New α<sub>1</sub>B Allele
|journal=Human Heredity
|date=1989
|volume=39
|issue=1
|pages=32-36
|url=https://www.karger.com/Article/Abstract/153828
|arxiv=
|bibcode=
|doi=10.1159/000153828
|pmid=2759622
|accessdate=25 March 2020 }}</ref>

"Genetic polymorphism of human plasma 𝜶<sub>1</sub>B-glycoprotein (𝜶<sub>1</sub>B) was reported first, in brief, by Altland ''et al.'' [1983; also given in Altkand and Hacklar, 1984]. A detailed description of human 𝜶<sub>1</sub>B polymorphism was reported in subsequent studies [Gahne ''et al.'', 1987; Juneja ''et al.'', 1988, 1989]. Five different 𝜶<sub>1</sub>B alleles (''A1B*1, A1B*2, A1B*3, A1B*4'' and ''A1B*5'') were reported. In Caucasian whites, the frequencies of ''A1B*1'' and ''''A1B*2'' were about 0.95 and 0.05, respectively. ''A1B*4'' was observed in 2 related Czech individuals. In American blacks, ''A1B*1'' and ''A1B*2'' occurred with a frequency of 0.73 and 0.21, respectively, while a new allele, viz, ''A1B*3'' had a frequency of 0.06. ''A1B*5'' was observed only in Swedish Lapps and in Finns with a frequency of 0.04 and 0.007, respectively."<ref name=Juneja>{{ cite journal
|author=R.K. Juneja, N. Saha, B. Gahne and J.S.H. Tay
|title=Distribution of Plasma Alpha-1-B-Glycoprotein Phenotypes in Several Mongoloid Populations of East Asia
|journal=Human Heredity
|date=1989
|volume=39
|issue=
|pages=218-222
|url=https://www.karger.com/Article/PDF/153863
|arxiv=
|bibcode=
|doi=10.1159/000153863
|pmid=2583734
|accessdate=25 March 2020 }}</ref>

"The frequency of ''A1B*1'' varied from 0.89 to 0.91 and that of ''A1B*2'' from 0.08 to 0.10. The ''A1B*3'' allele, reported previously only in American blacks, was observed with a frequency range of 0.003-0.01 in 3 of the Chinese populations, in Koreans and in Malays. A new 𝜶<sub>1</sub>B allele (''A1B*6'') was observed in 2 Chinese individuals."<ref name=Juneja/>

====Phenotypes====

'''Def.''' the "appearance of an organism based on a single trait [multifactorial combination of genetic traits and environmental factors]<ref name=PhenotypeWikt2>{{ cite web
|author=[[wikt:User:24.235.196.118|24.235.196.118]]
|title=phenotype
|publisher=Wikimedia Foundation, Inc
|location=San Francisco, California
|date=23 September 2007
|url=https://en.wiktionary.org/wiki/phenotype
|accessdate=2016-10-04 }}</ref>, especially used in pedigrees"<ref name=PhenotypeWikt1>{{ cite web
|author=[[wikt:User:SemperBlotto|SemperBlotto]]
|title=phenotype
|publisher=Wikimedia Foundation, Inc
|location=San Francisco, California
|date=14 February 2005
|url=https://en.wiktionary.org/wiki/phenotype
|accessdate=2016-10-04 }}</ref> or any "observable characteristic of an organism, such as its morphological, developmental, biochemical or physiological properties, or its behavior"<ref name=PhenotypeWikt>{{ cite web
|author=[[wikt:User:N2e|N2e]]
|title=phenotype
|publisher=Wikimedia Foundation, Inc
|location=San Francisco, California
|date=3 July 2008
|url=https://en.wiktionary.org/wiki/phenotype
|accessdate=2016-10-04 }}</ref> is called a '''phenotype'''.

"The three different phenotypes of α1B observed (designated 1-1, 1-2, and 2-2) were apparently identical to those reported by Altland et al. (1983), who used double one-dimensional electrophoresis. Family data supported the hypothesis that the three α1B phenotypes are determined by two codominant alleles at an autosomal locus, designated A1B. Allele frequencies in a Swedish population were: A1B *1, 0.937; A1B *2, 0.063; PIC, 0.111."<ref name=Gahne/>

====Protein species====

"Both protein species of [alpha 1-beta glycoprotein] A1B (A1Ba, p = 0.008; f.c.= +1.62, A1Bb, p = 0.003; f.c. = +1.82) [...] were apparently overexpressed in patients with PTCa [...]."<ref name=Abdullah>{{ cite journal
|author=Mardiaty Iryani Abdullah, Ching Chin Lee, Sarni Mat Junit, Khoon Leong Ng, and Onn Haji Hashim
|title=Tissue and serum samples of patients with papillary thyroid cancer with and without benign background demonstrate different altered expression of proteins
|journal=Peer J
|date=13 September 2016
|volume=4
|issue=
|pages=e2450
|url=https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5028788/
|arxiv=
|bibcode=
|doi=10.7717/peerj.2450
|pmid=27672505
|accessdate=15 March 2020 }}</ref>

A1BG is mainly produced in the liver, and is secreted to plasma to levels of approximately 0.22 mg/mL.<ref name=Ishioka/>

===CRISPs===

The human cysteine-rich secretory protein (CRISP3) "is present in exocrine secretions and in secretory granules of neutrophilic granulocytes and is believed to play a role in innate immunity."<ref name=Udby>{{ cite journal
|author=Udby L, Sørensen OE, Pass J, Johnsen AH, Behrendt N, Borregaard N, Kjeldsen L.
|title=Cysteine-rich secretory protein 3 is a ligand of alpha1B-glycoprotein in human plasma
|journal=Biochemistry
|date=12 October 2004
|volume=43
|issue=40
|pages=12877-86
|url=https://pubs.acs.org/doi/10.1021/bi048823e
|arxiv=
|bibcode=
|doi=10.1021/bi048823e
|pmid=15461460
|accessdate=2011-11-28 }}</ref> CRISP3 has a relatively high content in human plasma.<ref name=Udby/>

"The A1BG-CRISP-3 complex is noncovalent with a 1:1 stoichiometry and is held together by strong electrostatic forces."<ref name=Udby/> "Similar [complex formation] between toxins from snake venom and A1BG-like plasma proteins ... inhibits the toxic effect of snake venom metalloproteinases or myotoxins and protects the animal from envenomation."<ref name=Udby/>

Opossums have a remarkably robust immune system, and show partial or total immunity to the venom of rattlesnakes, ''Agkistrodon piscivorus'', cottonmouths, and other ''Crotalinae'', pit vipers.<ref>{{ cite web
|url=http://www.wildliferescueleague.org/report/opossum.html
|title=The Opossum: Our Marvelous Marsupial, The Social Loner
|publisher=Wildlife Rescue League }}</ref><ref>[http://www.scielo.br/scielo.php?pid=S0104-79301999000100005&script=sci_arttext Journal Of Venomous Animals And Toxins – Anti-Lethal Factor From Opossum Serum Is A Potent Antidote For Animal, Plant And Bacterial Toxins]. Retrieved 2009-12-29.</ref>

"Crisp3 [is] mainly [expressed] in the salivary glands, pancreas, and prostate."<ref name=Haendler>{{ cite journal
|author=B Haendler, J Krätzschmar, F Theuring and W D Schleuning
|title=Transcripts for cysteine-rich secretory protein-1 (CRISP-1; DE/AEG) and the novel related CRISP-3 are expressed under androgen control in the mouse salivary gland.
|journal=Endocrinology
|date=July 1993
|volume=133
|issue=1
|pages=192-8
|url=http://endo.endojournals.org/content/133/1/192.full.pdf+html
|arxiv=
|bibcode=
|doi=10.1210/en.133.1.192
|pmid= 8319566
|accessdate=2012-02-20 }}</ref> "CRISP3 is highly expressed in the human cauda epididymidis and ampulla of vas deferens (Udby et al. 2005)."<ref name=Haendler/>

==A1BG-AS1==

Gene ID: 503538 is [[A1BG-AS1]] A1BG antisense RNA 1.<ref name=HGNC503538>{{ cite web
|author=HGNC
|title=A1BG-AS1 A1BG antisense RNA 1 [ Homo sapiens (human) ]
|publisher=National Center for Biotechnology Information
|location=U.S. National Library of Medicine, 8600 Rockville Pike, Bethesda MD, 20894 USA
|date=10 December 2019
|url=https://www.ncbi.nlm.nih.gov/gene/503538
|accessdate=2019-12-18 }}</ref> A1BG-AS1 is transcribed in the negative direction from ZSCAN22.<ref name=HGNC503538/>

Gene ID 503538 extends from 58,351,390 to 58,355,183. It is a long, non-coding (lnc) RNA.<ref name=Bai>{{ cite journal
|author=Jigang Bai, Bowen Yao, Liang Wang, Liankang Sun, Tianxiang Chen, Runkun Liu, Guozhi Yin, Qiuran Xu, Wei Yang
|title=lncRNA A1BG-AS1 suppresses proliferation and invasion of hepatocellular carcinoma cells by targeting miR-216a-5p
|journal=
|date=June 2019
|volume=120
|issue=6
|pages=10310-10322
|url=https://pubmed.ncbi.nlm.nih.gov/30556161/
|arxiv=
|bibcode=
|doi=10.1002/jcb.28315
|pmid=30556161
|accessdate=16 May 2023 }}</ref> Extensive evidence indicates that long noncoding RNAs (lncRNAs) regulate the tumorigenesis and progression of hepatocellular carcinoma (HCC).<ref name=Bai/>

The underexpression of A1BG-AS1 was found in HCC via analysis of The Cancer Genome Atlas database.<ref name=Bai/> A1BG-AS1 expression in HCC was markedly lower than that in noncancerous tissues.<ref name=Bai/>

==ZNF497==
{{main|ZNF497}}

Gene ID: 162968 is [[ZNF497]] zinc finger protein 497.<ref name=HGNC162968>{{ cite web
|author=HGNC
|title=ZNF497 zinc finger protein 497 [ Homo sapiens (human) ]
|publisher=National Center for Biotechnology Information
|location=U.S. National Library of Medicine, 8600 Rockville Pike, Bethesda MD, 20894 USA
|date=10 December 2019
|url=https://www.ncbi.nlm.nih.gov/gene/162968
|accessdate=2019-12-18 }}</ref> ZNF497 is transcribed in the positive direction from RNA5SP473.<ref name=HGNC162968/>
# NP_001193938.1 zinc finger protein 497: "Transcript Variant: This variant (2) lacks an alternate exon in the 5' UTR, compared to variant 1. Variants 1 and 2 encode the same protein."<ref name=HGNC162968/>
# NP_940860.2 zinc finger protein 497: "Transcript Variant: This variant (1) is the longer transcript. Variants 1 and 2 encode the same protein."<ref name=HGNC162968/>

Gene ID: 100419840 is LOC100419840 zinc finger protein 446 pseudogene.<ref name=HGNC100419840>{{ cite web
|author=HGNC
|title=LOC100419840 zinc finger protein 446 pseudogene [ Homo sapiens (human) ]
|publisher=National Center for Biotechnology Information
|location=U.S. National Library of Medicine, 8600 Rockville Pike, Bethesda MD, 20894 USA
|date=10 December 2019
|url=https://www.ncbi.nlm.nih.gov/gene/100419840
|accessdate=2019-12-18 }}</ref> LOC100419840 may be transcribed in the positive direction from LOC105372483.<ref name=HGNC100419840/>

Gene ID: 105372483 is LOC105372483 uncharacterized LOC105372483 ncRNA.<ref name=HGNC105372483>{{ cite web
|author=HGNC
|title=LOC105372483 uncharacterized LOC105372483 [ Homo sapiens (human) ]
|publisher=National Center for Biotechnology Information
|location=U.S. National Library of Medicine, 8600 Rockville Pike, Bethesda MD, 20894 USA
|date=10 December 2019
|url=https://www.ncbi.nlm.nih.gov/gene/105372483
|accessdate=2019-12-18 }}</ref> LOC105372483 is transcribed in the negative direction from LOC100419840.<ref name=HGNC105372483/>

Gene ID: 106479017 is RNA5SP473 RNA, 5S ribosomal pseudogene 473.<ref name=HGNC106479017>{{ cite web
|author=HGNC
|title=RNA5SP473 RNA, 5S ribosomal pseudogene 473 [ Homo sapiens (human) ]
|publisher=National Center for Biotechnology Information
|location=U.S. National Library of Medicine, 8600 Rockville Pike, Bethesda MD, 20894 USA
|date=10 December 2019
|url=https://www.ncbi.nlm.nih.gov/gene/106479017
|accessdate=2019-12-18 }}</ref> RNA5SP473 may be transcribed in the negative direction from ZNF497.<ref name=HGNC106479017/>

==GC contents==

Approximately "76% of human core promoters lack TATA-like elements, have a high GC content, and are enriched in Sp1 binding sites."<ref name=Yang2>{{ cite journal
|author=Chuhu Yang, Eugene Bolotin, Tao Jiang, Frances M. Sladek, Ernest Martinez.
|title=Prevalence of the initiator over the TATA box in human and yeast genes and identification of DNA motifs enriched in human TATA-less core promoters
|journal=Gene
|month=March 7,
|year=2007
|volume=389
|issue=1
|pages=52-65
|pmid=17123746
|doi=10.1016/j.gene.2006.09.029
|url=http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1955227/?tool=pubmed }}</ref>

CpG islands typically occur at or near the transcription start site of genes, particularly housekeeping genes, in vertebrates.<ref name="Saxonov2006">{{ cite journal
|author=Saxonov S, Berg P, Brutlag DL
|title=A genome-wide analysis of CpG dinucleotides in the human genome distinguishes two distinct classes of promoters
|journal=Proc Natl Acad Sci USA
|volume=103
|issue=5
|pages=1412–1417
|date=2006
|pmid=16432200
|pmc=1345710
|doi=10.1073/pnas.0510310103 }}</ref>

The number of CG or GC pairs near the TSS for A1BG appears to be low: between ZSCAN22 and A1BG are 8.2 % CG/GC and between ZNF497 and A1BG are 15 % CG/GC.

==19q13.43==
{{main|Genes on 19q13.43}}

==Regulatory elements and regions==
{{main|A1BG regulatory elements and regions}}

==Functions of A1BG==

"Receptors of the leukocyte receptor cluster (LRC) play a range of important functions in the human immune system."<ref name=Guselnikov>{{ cite journal
|author=Sergey V Guselnikov and Alexander V Taranin
|title=Unraveling the LRC Evolution in Mammals: IGSF1 and A1BG Provide the Keys
|journal=Genome Biology and Evolution
|date=1 June 2019
|volume=11
|issue=6
|pages=1586-1601
|url=
|arxiv=
|bibcode=
|doi=10.1093/gbe/evz102
|pmid=31106814
|accessdate=31 January 2021 }}</ref>

"The leukocyte receptor cluster (LRC) is a family of structurally related genes for immunoregulatory receptors. Originally, the term LRC was introduced to emphasize the linkage of the genes encoding killer immunoglobulin-like receptors (KIRs), leukocyte Ig-like receptors (LILRs), and FcαR on human chromosome 19q13.4 (Wagtmann et al. 1997; Wende et al. 1999). Subsequently, it has been found that the region contains some other structurally related genes, such as ''NCR1, GPVI, LAIR1, LAIR2,'' and ''OSCAR'' (Meyaard et al. 1997; Sivori et al. 1997; Clemetson et al. 1999; Kim et al. 2002). Most recently, the LRC has been further extended by adding two more genes named ''VSTM1/SIRL1'' and ''TARM1'' (Steevels et al. 2010; Radjabova et al. 2015)."<ref name=Guselnikov/>

"Except for LAIR2, which is a secreted protein, all human LRC products are type I cell surface receptors with extracellular regions composed of 1–4 C2-type Ig-like domains."<ref name=Guselnikov/>

The "eutherian LRC family, in addition to commonly recognized members, includes two new, IGSF1 and alpha-1-B glycoprotein (A1BG)."<ref name=Guselnikov/>

"Nucleotide sequences were retrieved and analyzed using utilities at the NCBI (https://www.ncbi.nlm.nih.gov/, last accessed May 20, 2019) and Ensemble (http://www.ensembl.org, last accessed May 20, 2019) websites."<ref name=Guselnikov/>

"In our previous studies, it was observed that the Ig-like domains of the frog and chicken LRC proteins reproducibly showed homology not only to known LRC members but also to the products of four mammalian genes that to our knowledge have never been considered in the phylogenetic analyses of LRC. These genes are ''VSTM1, TARM1, A1BG,'' and ''IGSF1''. ''VSTM1'' and ''TARM1'' are the most recently identified members of the human LRC (Steevels et al. 2010; Radjabova et al. 2015). ''A1BG'' encodes alpha-1 B glycoprotein, a soluble component of mammalian blood plasma that is known for half a century (Schultze et al. 1963). The protein is composed of five Ig-like domains and has been shown to bind to CRISP-3, a small polypeptide that is present in exocrine secretions of neutrophilic granulocytes and that is believed to play a role in innate immunity (Udby et al. 2004). In the human genome, ''A1BG'' maps to 19q13.4 some 3.3 Mb away from ''GPVI'' [...]."<ref name=Guselnikov/>

"The attribution of IGSF1 and A1BG domains to the LRC was supported by their 3D structures predicted using homology modeling [...]."<ref name=Guselnikov/>

"Noteworthy is that the D1 and D6 domains of IgSF1 fall into one clade with the N-terminal (d1) domains of A1BG and OSCAR (cluster B1). Closer relationship of A1BG and OSCAR was supported by clustering of the d2–d5 domains of A1BG with membrane-proximal (d2) domain of OSCAR (cluster B2)."<ref name=Guselnikov/>

"Altogether, these results support the attribution of IGSF1 and A1BG to the LRC and suggest their relatedness to OSCAR, TARM1, and VSTM1."<ref name=Guselnikov/>

"Clustering of the N-terminal domains of OSCAR, IGSF1, and A1BG with each other and with IGSF1 d6 was also reproduced. Finally, the d2 domains of OSCAR cluster with the d2–d5 domains of A1BG (fig. 5). These results further justify grouping IGSF1, A1BG, OSCAR, TARM1, and VSTM1 into a distinct group B."<ref name=Guselnikov/>

==Hypotheses==
# [[Downstream core element gene transcriptions|Downstream core promoters]] may work as transcription factors even as their complements or inverses.
# In addition to the DNA binding sequences listed above, the transcription factors that can open up and attach through the local epigenome need to be known and specified.
# Each DNA binding domain serving as a transcription factor for the promoter of any immunoglobulin supergene family member, also serves or is present in the promoters for A1BG.
# The function of A1BG is the same as other immunoglobulin genes possessing the immunoglobulin domain '''cl11960''' and/or any of three immunoglobulin-like domains: '''pfam13895''', '''cd05751''' and '''smart00410''' in the order and nucleotide sequence: '''cd05751''' Location: 401 → 493, '''smart00410''' Location: 218 → 280, '''pfam13895''' Location: 210 → 301 and '''cl11960''' Location: 28 → 110.

==See also==
{{div col|colwidth=20em}}
* [[A1BG gene transcription core promoters]]
* [[A1BG gene transcriptions]]
* [[A1BG regulatory elements and regions]]
* [[A1BG response element gene transcriptions]]
* [[A1BG response element negative results]]
* [[A1BG response element positive results]]
* [[Alpha-1-B glycoprotein]]
* [[Immunoglobulin domain cl11960]]
* [[Immunoglobulin like domain cd05751]]
* [[Immunoglobulin like domain pfam13895]]
* [[Immunoglobulin like domain smart00410]]
* [[Immunoglobulin supergene family]]
* [[Nuclear factor gene transcriptions]]
* [[SCAN domain]]
{{Div col end}}

==References==
{{reflist|2}}

==External links==
* [http://www.genome.jp/ GenomeNet KEGG database]
* [http://www.ncbi.nlm.nih.gov/sites/entrez?db=gene Home - Gene - NCBI]
* [http://www.ncbi.nlm.nih.gov/sites/gquery NCBI All Databases Search]
* [http://www.ncbi.nlm.nih.gov/ncbisearch/ NCBI Site Search]

<!-- footer templates -->
{{Gene project}}{{Transcription factors and intracellular receptors}}{{tlx|Phosphate biochemistry}}

<!-- footer categories -->