View source for Haplogroup R1b (Y-DNA)

[[Image:Y-Haplogroup R1 distribution.png|thumb|300px|Distribution of R1a (purple) and '''R1b''' (red).]]
In [[human genetics]], '''Haplogroup R1b'''  is the most frequent [[Y chromosome|Y-chromosome]] [[haplogroup]] in [[Western Europe]].

Its frequency is highest in [[Western Europe]], especially in [[Atlantic Europe]] (and due to European emigration, in [[North America]], [[South America]], and [[Australia]]). In southern [[England]], the frequency of R1b is about 70%, and in parts of north and western [[England]], [[Spain]], [[Portugal]], [[France]], [[Wales]], and [[Ireland]], the frequency of R1b is greater than 90%.{{fact|date=December 2007}}

==Nomenclature==
[[Haplogroup]] R1b is defined by the presence of [[List of Y-DNA single nucleotide polymorphisms|single nucleotide polymorphism (SNP)]] '''M343''', which was discovered in 2004.<ref>{{cite journal |title=Excavating Y-chromosome haplotype strata in Anatolia |last=Cinnioğlu |first=Cengiz |coauthors=''et al'' |doi=10.1007/s00439-003-1031-4 |journal=[[Human Genetics (journal)|Human Genetics]] |volume=114 |issue=2 |pages=127-148 |date=January 2004 |accessdate=2007-12-13}}</ref>  From 2002 to 2005, R1b was defined by the presence of SNP P25; prior to 2002, today's Haplogroup R1b had a number of names in differing nomenclature systems, such as '''Hg1''' and '''Eu18'''.<ref>{{cite web |url=http://ycc.biosci.arizona.edu/nomenclature_system/fig1.html |title=YCC NRY Tree 2002 |author=Y Chromosome Consortium |date=[[2002-01-18]] |accessdate=2007-12-13}}</ref>

[[Bryan Sykes]], in his book ''Blood of the Isles'', gives the populations associated with R1b the name of [[Oisín]] for a clan patriarch, much as he did for mitochondrial haplogroups in ''[[The Seven Daughters of Eve]]''. [[Stephen Oppenheimer]] also deals with this population group in his book ''Origins of the British''.

===Subclades===
R1b is a descendant of [[Haplogroup R (Y-DNA)|Haplogroup R1]], which is defined by the presence of SNP marker M173.
*R1b   (M343)   
**R1b[[* (haplogroup)|*]]
**R1b1   (P25)  
***R1b1[[* (haplogroup)|*]]
***R1b1a   (M18)
***R1b1b   (M73)
***R1b1c   (M269, S3, S10, S13, S17)
****R1b1c[[* (haplogroup)|*]]
****R1b1c1   (M37)
****R1b1c2   (M65)
****R1b1c3   (M126)
****R1b1c4   (M153)
****R1b1c5   (M160)
****R1b1c6   (SRY2627 (M167))
****R1b1c7   (M222)
****R1b1c8   (P66)
****R1b1c9   (S21)
*****R1b1c9[[* (haplogroup)|*]]
*****R1b1c9a   (L1 or S26)
*****R1b1c9b   (S29)   
****R1b1c10   (S28)
***R1b1d   (M335)

====R1b1c====
Most of the present-day European males with the M343 marker also have the P25 and M269 markers.  These markers define the '''R1b1c''' [[subclade]].  

This subgroup is believed by some to have existed before the last Ice Age and has been associated with the [[Aurignacian|Aurignacian culture]]<ref>[http://www.sciencemag.org/cgi/content/abstract/290/5494/1155?ck=nck ''The Genetic Legacy of Paleolithic Homo sapiens sapiens in Extant  Europeans: A Y Chromosome Perspective'' - Ornella Semino et al., 2000]</ref> (32,000 - 21,000 BC). Although the precise route of the M269 marker is not known, it has been theorized to originate in Central Asia/South Central Siberia. Archeological evidence supports the view of the arrival of Aurignacian culture to Anatolia from Europe during the Upper Paleolithic rather than from the Iranian plateau<ref>[http://hpgl.stanford.edu/publications/HG_2004_v114_p127-148.pdf ''Excavating Y-chromosome haplotype strata in Anatolia'', Cinnioglu et al., 2003]</ref>. It could have entered prehistoric Europe from the area of Ukraine/Belarus or Central Asia ([[Kazakhstan]]) via the coasts of the [[Black Sea]] and the [[Baltic Sea]]. It is considered widespread in Europe throughout the Paleolithic already before the [[Wisconsin glaciation|last Ice Age]].<ref>[http://www.isogg.org/tree/ISOGG_HapgrpR.html International Society of Genetic Genealogy (ISOGG) - haplogroup R]</ref> 

Traditionally this culture is associated with the [[Cro-Magnon|Cro-Magnon people]], the first [[Human|modern humans]] to enter Europe. However, this view has recently been challenged.<ref>Rapid ecological turnover and its impact on Neanderthal and other human populations - Clive Finlayson and Jose´ S. Carrión, Trends in Ecology & Evolution, Volume 22, Issue 4 , April 2007, Pages 213-222 [http://www.jscarrion.com/pdf/finlayson_carrion.pdf] </ref> The people of the Aurignacian culture were the first documented [[Pre-historic art|human artists]], making sophisticated [[cave paintings]]. Famous sites include [[Lascaux]] in [[France]], [[Cueva de las Monedas]] in [[Spain]] and [[Valley of Foz Côa]] in [[Portugal]] (the largest open-air site in Europe). 

[[Image:Europe20000ya.png|thumb|250px|European LGM refuges, 20 kya.]]
The glaciation of the ice age intensified, and the continent became increasingly uninhabitable.  The genetic diversity narrowed through [[founder effect]]s and [[population bottleneck]]s, as the population became limited to a few coastal refugia in Southern Europe.  The present-day population of R1b in Western Europe are believed to be the descendants of a refugium in the Iberian peninsula (Portugal and Spain), where the R1b1c haplogroup may have achieved [[Population genetics|genetic homogeneity]]. As conditions eased with the [[Allerød Oscillation]] in about 12,000 BC, descendants of this group migrated and eventually recolonised all of Western Europe, leading to the dominant position of R1b in variant degrees from [[Iberian peninsula|Iberia]] to [[Scandinavia]], so evident in [http://www.scs.uiuc.edu/~mcdonald/WorldHaplogroupsMaps.pdf haplogroup maps].

An alternative  belief is that R1b represents the Western or [[Centum-Satem isogloss|centum]]-speaking branch of the Proto-Indo-Europeans, although this remains uncertain. 

A second R1b1c population, reflected in a somewhat different distribution of haplotypes of the more rapidly varying [[Y-STR]] markers, appear to have survived alongside other haplogroups in Eastern Europe.  However, they do not have the same dominance that R1b has in Western Europe.  Instead the most common haplogroup in Eastern Europe is [[Haplogroup R1a1 (Y-DNA)|haplogroup R1a1]].

Note that haplogroup R1b and haplogroup R1a first existed at very different times. The mutations that characterize haplogroup R1b occurred ~30,000 years bp, whereas the mutations that characterize haplogroup R1a occurred ~10,000 years bp.

(Note that in earlier literature the M269 marker, rather than M343, was used to define the R1b haplogroup.  Then, for a time (from 2003 to 2005) what is now R1b1c was designated R1b3.  This shows how nomenclature can evolve as new markers are discovered and then investigated).

To date about 50% of R1b1c (M269+) men are negative for all of the known R1b1c subclades and are therefore classed as members of the paragroup R1b1c*. R1b1c* is not a subclade. Men of varying haplotypes and places of ancestral origin comprise its membership. Thus R1b1c* should not be considered as a single clade-like entity with any single geographic locus.

'''R1b1c4''' (M153): This haplogroup has been found so far in 39 individuals, most of them [[Basque people|Basques]], the rest were likely of [[Iberian peninsula|Iberian]] ancestry or have not been classified ethnically<ref>[http://www.geocities.com/mcewanjc/m153.htm McEwan's Genealogy Page: "R1b1c4 aka M153"]</ref>. The first time it was located (Bosch 2001<ref>[http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=11254456E. Bosch et al, ''High-Resolution Analysis of Human Y-Chromosome Variation Shows a Sharp Discontinuity and Limited Gene Flow between Northwestern Africa and the Iberian Peninsula'', 2001]</ref>) it was described as H102 and included 7 Basques and one Andalusian. 

'''R1b1c6''' (SRY2627 (M167)): The first author to test for this marker (long before modern haplogroup nomenclature existed) was Hurles in 1999<ref>[http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=10521311 M.E. Hurles et al, ''Recent Male-Mediated Gene Flow over a Linguistic Barrier in Iberia, Suggested by Analysis of a Y-Chromosomal DNA Polymorphism'', 1999]</ref>. He found it relatively common among Basques (13/117: 11%) and [[Catalonia|Catalans]] (7/32: 22%). Other occurrences were found among other [[Spain|Spanish]], [[Béarn]]ais, other [[France|French]], [[United Kingdom|British]] and [[Germany|Germans]]. 

In 2000, Rosser<ref>[http://www.pubmedcentral.nih.gov/articlerender.fcgi?&pubmedid=11078479 Z.H. Rosser et al, ''Y-Chromosomal Diversity in Europe Is Clinal and Influenced Primarily by Geography, Rather than by Language'', 2000]</ref> also tested for that same marker, naming the haplogroup '''Hg22''', and again it was found mainly among Basques (19%), in lower frequencies among French (5%), [[Bavaria]]ns (3%) Spanish (2%), Southern [[Portugal|Portuguese]] (2%), and in single occurrences among [[Romania]]ns, [[Slovenia]]ns, [[Netherlands|Dutch]], [[Belgium|Belgians]] and [[England|English]]. 

In 2001, Bosch<ref>[http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=11254456E. Bosch et al ''High-Resolution Analysis of Human Y-Chromosome Variation Shows a Sharp Discontinuity and Limited Gene Flow between Northwestern Africa and the Iberian Peninsula'', 2001]</ref> described this marker as H103, in 5 Basques and 5 Catalans. Further regional studies<ref>[http://www.geocities.com/mcewanjc/m167.htm McEwan Genealogy Page: "M167 aka SRY2627 R1b1c6 subclade"]</ref> have located it in significative amounts in [[Asturias]], [[Cantabria]] and [[Galicia]], as well as again among Basques. Cases in the [[Azores]] and [[Latin America]] have also been reported. A total of 85 individuals with this haplogroup have been found so far, almost all of them in academic studies, making it the best documented R1b1c subclade<ref>[http://www.geocities.com/mcewanjc/r1bsummary.htm McEwan's Genealogy Page: "Summary of published results in the R subclade"]</ref>. 

The subclade '''R1b1c7''' (M222), on the other hand, is associated with the [[Irish people|Irish]] and [[Scottish people|Scots]]; in this case, the relatively high frequency of this specific subclade among the population of certain counties in northwestern [[Ireland]] may be due to positive social selection, as R1b1c7-M222 is believed to have been the Y-chromosome haplogroup of the kings of the [[Uí Néill]] clan of ancient Ireland.

The '''R1b1c9''' (S21) subclade, although recently discovered by EthnoAncestry, appears to be the most common downstream marker from R1b1c appearing in over 35% of those tested. This group has a maximum in [[Frisia]] (the Netherlands) and, in general, is the predominant R1b haplogroup. It may have originated towards the end of the last ice age, or perhaps more or less 7000 BC, possibly in the northern European mainland.[http://www.geocities.com/mcewanjc/s21comment.htm] The exact technical definition of the SNP was not initially released for commercial reasons, but the same marker was subsequently independently identified (as their "U106") by Sims et al (2007) [http://www3.interscience.wiley.com/homepages/38515/pdf/940.pdf].

The '''R1b1c9a''' subclade is defined by the L1/S26 SNP and is downsteam of S21. It occurs in less than a half a percent of R1b males, mainly with roots in the south and east of England and in Germany.  '''L1''' was first discovered by Family Tree DNA, then confirmed and named '''S26''' by EthnoAncestry.  L1/S26 is located in the flanking region of DYS439, and when it occurs, it inhibits the FTDNA primers from binding, thus producing an apparent null allele or "'''null439'''".  FTDNA displays null alleles at DYS439 with a '''<font color=blue>Blue 12</font>''' on public pages, and with a '''<font color=blue>Blue asterisk</font>''' beside 439 on personal results pages.  Other testing companies do report detecting null 439s.  For further information, see the '''null439 project''' at [http://www.familytreedna.com/public/null439].  

The '''R1b1c9b''' subclade is defined by S29 and is downsteam of S21. It was discovered by EthnoAncestry, and has to date been found primarily in southern England (although this may reflect a sampling bias).  Recent findings show that it also occurs in Germany in the region previously inhabited by the Saxons.  Further studies will serve to ascertain whether this is a native Briton marker, or Continental and having arrived in England with the Anglo - Saxons in the 5th Century.

The '''R1b1c10''' (S28) subclade's discovery was announced in 2005 by EthnoAncestry.  Although sample sizes are relatively small, it appears to reach a maximum in [[Alps|Alpine]] [[Germany]] and [[Switzerland]]. Ethnoancestry's commercial and research branches have shown that S28 is found from Greece westward to the [[Bay of Biscay]] in France.  It appears to follow the distribution of the [[La Tene]] Celtic peoples.  The percentages here are much less than found in the Alps.  It has yet to be found anywhere in Ireland or Spain.  Northern Italy seems to be a meeting place for both S21 and S28.  Like S21, S28's specifications were not initially officially published by EthnoAncestry against their previous assertions that data would be publicly published; but again the marker was subsequently identified independently (as their "U152") by Sims et al (2007). [http://www.geocities.com/mcewanjc/s28.htm]

The newest Y-SNP to surface is S68, which was reported by EthnoAncestry in 2007.  It was originally considered to be what was once referred to as a "private SNP" and by EthnoAncestry as a "Family SNP", but was recently seen in someone from another part of Europe, and with a different surname.  It is only with continued research that the time depth of these markers can be estimated.  At present S68 has been seen in an individual from Scotland and another from Sweden.  EthnoAncestry has determined that this subclade (tentatively identified as '''R1b1c11''') is unlikely to be found in much more than 2% of the R1b population and is thus not considered a polymorphism.

====Other subclades====
Populations characterised as '''R1b1a''' (M18), '''R1b1b''' (M73), and '''R1b1d''' (M335),  with those mutually exclusive distinctive markers but no M269 have been found, in [[Sardinia]], Eurasia, and Anatolia respectively.  It is presumed that these are descendants of R1b1 populations which found other refuges from the ice.

An apparent R1b1* population has been found among the [[Ouldeme]] of Northern [[Cameroon]] in west central Africa. [http://hpgl.stanford.edu/publications/AJHG_2002_v70_p1197-1214.pdf] [http://www.u.arizona.edu/~ewood/Wood_et_al_EJHG_2005.pdf]

==Modal haplotypes==
Within the R1b haplogroup are modal haplotypes.  One of the best-characterized  of these haplotypes is the [[Atlantic Modal Haplotype]] (AMH). This haplotype reaches the highest frequencies in the Iberian Peninsula and in the [[British Isles]]. In the [[Iberian Peninsula]] it reaches 33% in [[Portugal]].

There also exists a haplotype of R1b with the DYS393=12 which is known in the literature as Haplotype 35, or ht35, as opposed to the AMH which is known as haplotype 15.  They can be found in high numbers in Southeastern Europe and Western Asia. The members of this haplotype are thought to be descended from early R1b's who found shelter in Anatolia during the [[Last Glacial Maximum]] instead of in Iberia. They can be found in high numbers in the [[Armenian Highland]] and [[Armenia]] with smaller numbers throughout the Middle East, in Jewish populations, in Southeastern Europe, and in the Caucasus Mountains. There is also a sizable pocket of ht35 in [[Uyghur]] populations in western China, which is thought to be a remnant of the Tocharians, an Indo-European speaking people that inhabited the Tarim Basin in Central Asia until they were later absorbed by various Turkic peoples. Ht35 is also present in Britain in areas that were found to have a high concentration of Haplogroup J, suggesting they arrived together, perhaps through Roman soldiers. For further information and different subgroups of ht35, see [http://freepages.genealogy.rootsweb.com/~gallgaedhil/haplo_r1b_ht35.htm] .

* R1b Modal Haplotype.  [http://www.ysearch.org/lastname_view.asp?uid=&letter=&lastname=R1b&viewuid=55GU9&p=0 Ysearch 55GU9 ]
* R1b Modal [http://www.ysearch.org/lastname_view.asp?uid=&letter=&lastname=R1b&viewuid=55GU9&p=0 Ysearch C7BED]
* R1b (NW Irish) Modal [http://www.ysearch.org/lastname_view.asp?uid=&letter=&lastname=modal&viewuid=M5UKQ&p=0 Ysearch M5UKQ ]
* [http://www.ysearch.org/research_comparative.asp?uid=&vallist=+55GU9%2C+C7BED%2C+M5UKQ Comparison]

===Niall of the Nine Hostages ===
In 2006, a subgroup of R1b common among people of Irish patrilineal descent was identified as the probable haplotype of many within the septs associated with [[Niall of the Nine Hostages]], an Irish king in the Dark Ages. SNP testing has shown that the cluster of haplotypes purported to be associated with the patrilineal descendants of the Uí Néill clan displays the M222 mutation that defines Haplogroup R1b1c7.

== Relationship to other haplogroups ==
{{Y-DNA}}

{{Clade
| label1=[[Haplogroup R (Y-DNA)|Haplogroup R]]
| 1={{Clade
  | label1=Haplogroup R1
  | 1={{Clade
     | 1=[[Haplogroup R1a (Y-DNA)|Haplogroup R1a]]
     | 2=[[Haplogroup R1b (Y-DNA)|Haplogroup R1b]]}}
  | 2=[[Haplogroup R2 (Y-DNA)|Haplogroup R2]]}}
}}

== Technical specification of mutation ==
The technical details of M343 are:

:Nucleotide change: C to A
:Position (base pair): 402
:Total size (base pairs): 424
:Forward 5′→ 3′: tttaacctcctccagctctgca
:Reverse 5′→ 3′: acccccacatatctccagg 

This refers to a particular 424 [[base pair]] fragment of DNA that the [[polymerase chain reaction]] produces when one uses the two "primer" strands listed.

== See also ==
*[[Human Y-chromosome DNA haplogroup]]
*[[Atlantic Modal Haplotype]]
*[[Genealogical DNA test]]
*[[Prehistoric Europe]]

==References==
{{reflist|2}}
* {{cite book | author=Luigi Luca Cavalli-Sforza | title=The History and Geography of Human Genes | publisher=Princeton University Press | year=1994}}  ISBN 0-691-08750-4
* Semino et al (2000), [http://hpgl.stanford.edu/publications/Science_2000_v290_p1155.pdf The Genetic Legacy of Paleolithic Homo sapiens sapiens in Extant Europeans], Science, Vol '''290'''
* Wells et al (2001), [http://www.pnas.org/cgi/reprint/98/18/10244.pdf The Eurasian Heartland: A continental perspective on Y-chromosome diversity],  PNAS, Vol '''98'''

==External links==
* [http://www.relativegenetics.com/genomics/images/haploMaps/originals/R1b_large_RG.jpg Map of R1b]
* [http://mbe.oxfordjournals.org/cgi/content/full/22/10/1964/FIG6 Haplogroup R1b distribution map]
* [http://www.isogg.org/tree/ISOGG_HapgrpR.html International Society of Genetic Genealogy - 2006 tree of haplogroup R]
* [https://www3.nationalgeographic.com/genographic/atlas.html?card=my050 Spread of R1b], from the [[Genographic Project]], ''[[National Geographic]]''
* [http://www.vizachero.com/images/R1bClades.pdf R1b1c Subclade Maps: M167, M222, S21, S28]
* [http://www.ethnoancestry.com/R1b_map.html EthnoAncestry's Map of R1b with S21, S29 Subclades]
* [http://www.scs.uiuc.edu/~mcdonald/WorldHaplogroupsMaps.pdf World Haplogroup Maps] Note especially the dominance of R1b in Western Europe.
* [http://worldfamilies.net/y-haplogroups.html Worldfamilies.net Page on Haplogroups]
* [http://dgmweb.net/genealogy/DNA/DK/DanishDemes-YDNA-results-HgR1b.shtml Danish Demes Regional DNA Project:  Haplogroup R1b]
* [http://www.familytreedna.com/public/null439 null439 project]
* [http://member.tripod.com/~midgley/dna.html Travels on a DNA Molecule] Midgley
* [http://home.cfl.rr.com/wade3/Haplogroup%20R1b.htm Wade Surname Homepage]
* [http://www.dnaheritage.com/ysnpmarkers.asp General SNP Marker Page] DNA Heritage
* [http://www.geocities.com/mcewanjc/ John McEwan's Y Chromosome DNA Genealogy Page]
* [http://www.davidkfaux.org/shetlandhaplogroupR1b David Faux - Haplogroup R1b]

[[Category:Human Y-DNA haplogroups|R1b]]

[[pt:M343]]
{{WikiDoc Sources}}