KIAA1797: Difference between revisions

Jump to navigation Jump to search
m (Bot: HTTP→HTTPS)
 
m (1 revision imported)
 
(One intermediate revision by one other user not shown)
Line 1: Line 1:
{{Infobox_gene}}
{{Infobox gene}}
'''KIAA1797''' is a [[protein]] that in humans is encoded by the ''KIAA1797'' [[gene]].<ref name="entrez">{{cite web | title = Entrez Gene: KIAA1797| url = https://www.ncbi.nlm.nih.gov/sites/entrez?Db=gene&Cmd=ShowDetailView&TermToSearch=54914| accessdate = }}</ref>
'''KIAA1797''' is a [[protein]] that in humans is encoded by the ''KIAA1797'' [[gene]].<ref name="entrez">{{cite web | title = Entrez Gene: KIAA1797| url = https://www.ncbi.nlm.nih.gov/sites/entrez?Db=gene&Cmd=ShowDetailView&TermToSearch=54914| accessdate = }}</ref>


Line 5: Line 5:


== Gene ==
== Gene ==
KIAA1797 is a protein-coding gene in Homo sapiens. Alternate names for the gene are FLJ20375, OTTHUMP00000069845, and hypothetical protein LOC54914.<ref name="entrez"/> Located on chromosome 9 at area q21.3,<ref name="AceView">AceView NCBI Gene Information [https://www.ncbi.nlm.nih.gov/IEB/Research/Acembly/ AceView] {{webarchive |url=https://www.webcitation.org/5EyKBIn7A?url=http://www.ncbi.nlm.nih.gov/IEB/Research/Acembly/ |date=April 7, 2006 }}</ref> the entire gene including introns and [[exon]]s is 375,010 base pairs on the plus strand. There are 19 alternative splice variants. Longest variant yields a mRNA of 6117 base pairs.
KIAA1797 is a protein-coding gene in Homo sapiens. Alternate names for the gene are FLJ20375, OTTHUMP00000069845, and hypothetical protein LOC54914.<ref name="entrez" /> Located on chromosome 9 at area q21.3,<ref name="AceView">AceView NCBI Gene Information [https://www.ncbi.nlm.nih.gov/IEB/Research/Acembly/ AceView] {{webarchive |url=https://www.webcitation.org/5EyKBIn7A?url=http://www.ncbi.nlm.nih.gov/IEB/Research/Acembly/ |date=April 7, 2006 }}</ref> the entire gene including introns and [[exon]]s is 375,010 base pairs on the plus strand. There are 19 alternative splice variants. Longest variant yields a mRNA of 6117 base pairs.


=== Expression ===
=== Expression ===


KIAA1797 was determined to express ubiquitously at varying levels throughout the human body. Based on the EST profile of Unigene, KIAA1797 expression have been observed in tissues ranging from reproductive to secretory.<ref name="urlEST Profile - Hs.283322">{{cite web| url = https://www.ncbi.nlm.nih.gov/UniGene/ESTProfileViewer.cgi?uglist=Hs.283322| title = EST Profile - Hs.283322| publisher = National Center for Biotechnology Information, United States National Library of Medicine }}</ref>
KIAA1797 was determined to express ubiquitously at varying levels throughout the human body. Based on the EST profile of Unigene, KIAA1797 expression have been observed in tissues ranging from reproductive to secretory.<ref name="urlEST Profile Hs.283322">{{cite web| url = https://www.ncbi.nlm.nih.gov/UniGene/ESTProfileViewer.cgi?uglist=Hs.283322| title = EST Profile Hs.283322| publisher = National Center for Biotechnology Information, United States National Library of Medicine }}</ref>


[[File:Kiaa1797 expression pic.PNG|Kiaa1797 expression pic]]
[[File:Kiaa1797 expression pic.PNG|Kiaa1797 expression pic]]
Line 18: Line 18:
== Protein sequence ==
== Protein sequence ==


The main isoform of the human protein is 1801 amino acid long, a total of 200,072 Da.<ref name="AceView"/>
The main isoform of the human protein is 1801 amino acid long, a total of 200,072 Da.<ref name="AceView" />


Two distinct [[Domain of unknown function]](DUF) are found in the sequence.DUF3730 (465-682aa) appears two times in the sequence; this domain family is found in eukaryotes and is typically between 220 and 262 amino acids in length. DUF3028(1213-1801aa). No additional information was provided regarding this DUF.
Two distinct [[Domain of unknown function]](DUF) are found in the sequence.DUF3730 (465-682aa) appears two times in the sequence; this domain family is found in eukaryotes and is typically between 220 and 262 amino acids in length. DUF3028(1213-1801aa). No additional information was provided regarding this DUF.
Line 24: Line 24:
[[File:Kiaa1797 DUF pic.PNG|Kiaa1797 DUF pic]]
[[File:Kiaa1797 DUF pic.PNG|Kiaa1797 DUF pic]]


==Homology==
== Homology ==


KIAA1797 is well conserved in [[mammals]]. However, it is also found in non-mammalians with lower sequence identities.
KIAA1797 is well conserved in [[mammals]]. However, it is also found in non-mammalians with lower sequence identities.
Line 30: Line 30:
[[File:Ort of kiaa1797 pic.PNG|thumb|Ort of kiaa1797 pic]]
[[File:Ort of kiaa1797 pic.PNG|thumb|Ort of kiaa1797 pic]]


==Gene Neighborhood==
== Gene Neighborhood ==


KIAA1797 is downstream of MLLT3 and upstream of PTPLAD2. MLLT3 is involved with myeloid/lymphoid or mixed-lineage leukemia. PTPLAD2 is a protein tyrosine [[phosphatase]].
KIAA1797 is downstream of MLLT3 and upstream of PTPLAD2. MLLT3 is involved with myeloid/lymphoid or mixed-lineage leukemia. PTPLAD2 is a protein tyrosine [[phosphatase]].
Line 40: Line 40:
The exact function of KIAA1797 is not yet understood by the scientific community. It is, however, found to be a [[transmembrane proteins]].
The exact function of KIAA1797 is not yet understood by the scientific community. It is, however, found to be a [[transmembrane proteins]].


==References==
== References ==
{{reflist}}
{{reflist}}


==Further reading==
== Further reading ==
{{refbegin | 2}}
{{refbegin | 2}}
*{{cite journal  |vauthors=Rose JE, Behm FM, Drgon T, etal |title=Personalized smoking cessation: interactions between nicotine dose, dependence and quit-success genotype score. |journal=Mol. Med. |volume=16 |issue= 7-8 |pages= 247–53 |year=  |pmid= 20379614 |doi= 10.2119/molmed.2009.00159 |pmc=2896464}}
*{{cite journal  |vauthors=Rose JE, Behm FM, Drgon T, etal |title=Personalized smoking cessation: interactions between nicotine dose, dependence and quit-success genotype score. |journal=Mol. Med. |volume=16 |issue= 7-8 |pages= 247–53 |year=  |pmid= 20379614 |doi= 10.2119/molmed.2009.00159 |pmc=2896464}}
Line 50: Line 50:
*{{cite journal  |vauthors=Nagase T, Nakayama M, Nakajima D, etal |title=Prediction of the coding sequences of unidentified human genes. XX. The complete sequences of 100 new cDNA clones from brain which code for large proteins in vitro. |journal=DNA Res. |volume=8 |issue= 2 |pages= 85–95 |year= 2001 |pmid= 11347906 |doi=  10.1093/dnares/8.2.85}}
*{{cite journal  |vauthors=Nagase T, Nakayama M, Nakajima D, etal |title=Prediction of the coding sequences of unidentified human genes. XX. The complete sequences of 100 new cDNA clones from brain which code for large proteins in vitro. |journal=DNA Res. |volume=8 |issue= 2 |pages= 85–95 |year= 2001 |pmid= 11347906 |doi=  10.1093/dnares/8.2.85}}
{{refend}}
{{refend}}


{{gene-9-stub}}
{{gene-9-stub}}

Latest revision as of 07:41, 10 January 2019

VALUE_ERROR (nil)
Identifiers
Aliases
External IDsGeneCards: [1]
Orthologs
SpeciesHumanMouse
Entrez
Ensembl
UniProt
RefSeq (mRNA)

n/a

n/a

RefSeq (protein)

n/a

n/a

Location (UCSC)n/an/a
PubMed searchn/an/a
Wikidata
View/Edit Human

KIAA1797 is a protein that in humans is encoded by the KIAA1797 gene.[1]

A specific single-nucleotide polymorphism rs7875153 in KIAA1797 is associated with heart rate.[2]

Gene

KIAA1797 is a protein-coding gene in Homo sapiens. Alternate names for the gene are FLJ20375, OTTHUMP00000069845, and hypothetical protein LOC54914.[1] Located on chromosome 9 at area q21.3,[3] the entire gene including introns and exons is 375,010 base pairs on the plus strand. There are 19 alternative splice variants. Longest variant yields a mRNA of 6117 base pairs.

Expression

KIAA1797 was determined to express ubiquitously at varying levels throughout the human body. Based on the EST profile of Unigene, KIAA1797 expression have been observed in tissues ranging from reproductive to secretory.[4]

Kiaa1797 expression pic

mRNA

Predicted secondary mRNA structures in the 5'UTR and the 3'UTR are “ugagaugaacucgguaucuca” and “uccuaagagaggag” respectively. Other possible secondary structures are shown in the table below.

Protein sequence

The main isoform of the human protein is 1801 amino acid long, a total of 200,072 Da.[3]

Two distinct Domain of unknown function(DUF) are found in the sequence.DUF3730 (465-682aa) appears two times in the sequence; this domain family is found in eukaryotes and is typically between 220 and 262 amino acids in length. DUF3028(1213-1801aa). No additional information was provided regarding this DUF.

Kiaa1797 DUF pic

Homology

KIAA1797 is well conserved in mammals. However, it is also found in non-mammalians with lower sequence identities.

File:Ort of kiaa1797 pic.PNG
Ort of kiaa1797 pic

Gene Neighborhood

KIAA1797 is downstream of MLLT3 and upstream of PTPLAD2. MLLT3 is involved with myeloid/lymphoid or mixed-lineage leukemia. PTPLAD2 is a protein tyrosine phosphatase.

Kiaa1797 Gene hood

Function

The exact function of KIAA1797 is not yet understood by the scientific community. It is, however, found to be a transmembrane proteins.

References

  1. 1.0 1.1 "Entrez Gene: KIAA1797".
  2. Melton PE, Rutherford S, Voruganti VS, Göring HH, Laston S, Haack K, Comuzzie AG, Dyer TD, Johnson MP, Kent JW, Curran JE, Moses EK, Blangero J, Barac A, Lee ET, Best LG, Fabsitz RR, Devereux RB, Okin PM, Bella JN, Broeckel U, Howard BV, MacCluer JW, Cole SA, Almasy L (September 2010). "Bivariate genetic association of KIAA1797 with heart rate in American Indians: the Strong Heart Family Study". Hum. Mol. Genet. 19 (18): 3662–71. doi:10.1093/hmg/ddq274. PMC 2928129. PMID 20601674.
  3. 3.0 3.1 AceView NCBI Gene Information AceView Archived April 7, 2006, at WebCite
  4. "EST Profile – Hs.283322". National Center for Biotechnology Information, United States National Library of Medicine.

Further reading