LRRC24: Difference between revisions

Jump to navigation Jump to search
VisualWikitext
m (Bot: HTTP→HTTPS)
 
Line 9: Line 9:
| website = www.ncbi.nlm.nih.gov
| website = www.ncbi.nlm.nih.gov
| access-date = 2016-02-29
| access-date = 2016-02-29
}}</ref> ''LRRC24'' is composed of five exons, and only a single [[gene isoform]] has been identified.<ref name=":1" />[[File:Genomic View for LRRC24 Gene.png|thumb|GeneCards Genomic View for LRRC24 gene<ref name=":7">{{Cite web|url=http://www.genecards.org/cgi-bin/carddisp.pl?gene=LRRC24|website=www.genecards.org|access-date=2016-05-09| title=GeneCard}}</ref>|371x371px]]
}}</ref> ''LRRC24'' is composed of five exons, and only a single [[gene isoform]] has been identified.<ref name=":1" />[[File:Genomic View for LRRC24 Gene.png|thumb|GeneCards Genomic View for LRRC24 gene<ref name=":7">{{Cite web|url=https://www.genecards.org/cgi-bin/carddisp.pl?gene=LRRC24|website=www.genecards.org|access-date=2016-05-09| title=GeneCard}}</ref>|371x371px]]


== Protein ==
== Protein ==


=== General features ===
=== General features ===
LRRC24 is a transmembrane protein of unknown function. Human LRRC24 consists of 513 amino acids including a 23 amino acid signal peptide.<ref name=":1" /><ref name=":0">{{cite web|url=http://www.genecards.org/cgi-bin/carddisp.pl?gene=LRRC24|title=LRRC24 Gene (Protein Coding)|website=genecards.com|accessdate=February 22, 2016}}</ref> The mature form of the protein has a molecular weight of 52.9 kDa.<ref>{{cite journal | vauthors = Brendel V, Bucher P, Nourbakhsh IR, Blaisdell BE, Karlin S | title = Methods and algorithms for statistical analysis of protein sequences | journal = Proceedings of the National Academy of Sciences of the United States of America | volume = 89 | issue = 6 | pages = 2002–6 | date = March 1992 | pmid = 1549558 | pmc = 48584 | doi = 10.1073/pnas.89.6.2002 | bibcode = 1992PNAS...89.2002B }}</ref> The isoelectric point of the mature human protein is 7.98<ref name="Kozlowski">{{cite journal | vauthors = Kozlowski LP | title = IPC - Isoelectric Point Calculator | journal = Biology Direct | volume = 11 | issue = 1 | pages = 55 | date = October 2016 | pmid = 27769290 | doi = 10.1186/s13062-016-0159-9 | url = http://isoelectric.ovh.org/ }}</ref> The protein is largely composed of alpha helices.<ref>{{cite journal | vauthors = Borrelli KW, Vitalis A, Alcantara R, Guallar V | title = PELE:  Protein Energy Landscape Exploration. A Novel Monte Carlo Based Technique | journal = Journal of Chemical Theory and Computation | volume = 1 | issue = 6 | pages = 1304–11 | date = November 2005 | pmid = 26631674 | doi = 10.1021/ct0501811 | url = https://dx.doi.org/10.1021/ct0501811 }}</ref>
LRRC24 is a transmembrane protein of unknown function. Human LRRC24 consists of 513 amino acids including a 23 amino acid signal peptide.<ref name=":1" /><ref name=":0">{{cite web|url=https://www.genecards.org/cgi-bin/carddisp.pl?gene=LRRC24|title=LRRC24 Gene (Protein Coding)|website=genecards.com|accessdate=February 22, 2016}}</ref> The mature form of the protein has a molecular weight of 52.9 kDa.<ref>{{cite journal | vauthors = Brendel V, Bucher P, Nourbakhsh IR, Blaisdell BE, Karlin S | title = Methods and algorithms for statistical analysis of protein sequences | journal = Proceedings of the National Academy of Sciences of the United States of America | volume = 89 | issue = 6 | pages = 2002–6 | date = March 1992 | pmid = 1549558 | pmc = 48584 | doi = 10.1073/pnas.89.6.2002 | bibcode = 1992PNAS...89.2002B }}</ref> The isoelectric point of the mature human protein is 7.98<ref name="Kozlowski">{{cite journal | vauthors = Kozlowski LP | title = IPC - Isoelectric Point Calculator | journal = Biology Direct | volume = 11 | issue = 1 | pages = 55 | date = October 2016 | pmid = 27769290 | doi = 10.1186/s13062-016-0159-9 | url = http://isoelectric.ovh.org/ | pmc=5075173}}</ref> The protein is largely composed of alpha helices.<ref>{{cite journal | vauthors = Borrelli KW, Vitalis A, Alcantara R, Guallar V | title = PELE:  Protein Energy Landscape Exploration. A Novel Monte Carlo Based Technique | journal = Journal of Chemical Theory and Computation | volume = 1 | issue = 6 | pages = 1304–11 | date = November 2005 | pmid = 26631674 | doi = 10.1021/ct0501811 | url = https://dx.doi.org/10.1021/ct0501811 }}</ref>


=== Domains ===
=== Domains ===
LRRC24 is a single-pass [[transmembrane protein]]. The protein consists of six [[leucine-rich repeat]]s and an [[Immunoglobulin domain|immunoglobulin-like domain]].<ref name=":1" /><ref>{{Cite web
LRRC24 is a single-pass [[transmembrane protein]]. The protein consists of six [[leucine-rich repeat]]s and an [[Immunoglobulin domain|immunoglobulin-like domain]].<ref name=":1" /><ref>{{Cite web
| url = http://www.uniprot.org/uniprot/Q50LG9#family_and_domains
| url = https://www.uniprot.org/uniprot/Q50LG9#family_and_domains
| title = LRRC24 - Leucine-rich repeat-containing protein 24 precursor - Homo sapiens (Human) - LRRC24 gene & protein
| title = LRRC24 - Leucine-rich repeat-containing protein 24 precursor - Homo sapiens (Human) - LRRC24 gene & protein
| website = www.uniprot.org
| website = www.uniprot.org
Line 34: Line 34:
|Domain
|Domain
|24-50
|24-50
|Leucine rich repeat N-terminal domain (LRRNT)<ref name=":2">{{Cite web|url=http://www.uniprot.org/uniprot/Q50LG9|title=LRRC24 - Leucine-rich repeat-containing protein 24 precursor - Homo sapiens (Human) - LRRC24 gene & protein|website=www.uniprot.org|access-date=2016-05-09}}</ref><ref name=":3">{{Cite web|url=https://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi?seqinput=NP_001019849.2|title=NCBI Conserved Domain Search|website=www.ncbi.nlm.nih.gov|access-date=2016-05-09}}</ref>
|Leucine rich repeat N-terminal domain (LRRNT)<ref name=":2">{{Cite web|url=https://www.uniprot.org/uniprot/Q50LG9|title=LRRC24 - Leucine-rich repeat-containing protein 24 precursor - Homo sapiens (Human) - LRRC24 gene & protein|website=www.uniprot.org|access-date=2016-05-09}}</ref><ref name=":3">{{Cite web|url=https://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi?seqinput=NP_001019849.2|title=NCBI Conserved Domain Search|website=www.ncbi.nlm.nih.gov|access-date=2016-05-09}}</ref>
|-
|-
|Repeat
|Repeat
Line 88: Line 88:


== Interactions ==
== Interactions ==
Protein-protein interactions of LRRC24 implicate the protein with cell signaling, cell migration, and axon guidance. [[ROBO2]] was found to interact with LRRC24.<ref>{{cite journal | vauthors = Gilsohn E, Volk T | title = Fine tuning cellular recognition: The function of the leucine rich repeat (LRR) trans-membrane protein, LRT, in muscle targeting to tendon cells | journal = Cell Adhesion & Migration | volume = 4 | issue = 3 | pages = 368–71 | date = 2010-01-01 | pmid = 20404543 | pmc = 2958611 | doi = 10.4161/cam.4.3.11606 }}</ref><ref name=":6">{{cite journal | vauthors = Söllner C, Wright GJ | title = A cell surface interaction network of neural leucine-rich repeat receptors | journal = Genome Biology | volume = 10 | issue = 9 | pages = R99 | date = 2009-01-01 | pmid = 19765300 | pmc = 2768988 | doi = 10.1186/gb-2009-10-9-r99 }}</ref> Interestingly, ROBO2 is a member of the [[Roundabout (gene family)|Roundabout gene family]], which are well known to play a significant role in nervous system development. Also, LRRC24 was found to interact with LRRTM4, a protein believed to be involved in [[synaptogenesis]], as well as the maintenance of the nervous system in vertebrates.<ref name=":6" />
Protein-protein interactions of LRRC24 implicate the protein with cell signaling, cell migration, and axon guidance. [[ROBO2]] was found to interact with LRRC24.<ref>{{cite journal | vauthors = Gilsohn E, Volk T | title = Fine tuning cellular recognition: The function of the leucine rich repeat (LRR) trans-membrane protein, LRT, in muscle targeting to tendon cells | journal = Cell Adhesion & Migration | volume = 4 | issue = 3 | pages = 368–71 | date = 2010-01-01 | pmid = 20404543 | pmc = 2958611 | doi = 10.4161/cam.4.3.11606 }}</ref><ref name=":6">{{cite journal | vauthors = Söllner C, Wright GJ | title = A cell surface interaction network of neural leucine-rich repeat receptors | journal = Genome Biology | volume = 10 | issue = 9 | pages = R99 | date = 2009-01-01 | pmid = 19765300 | pmc = 2768988 | doi = 10.1186/gb-2009-10-9-r99 }}</ref> ROBO2 is a member of the [[Roundabout (gene family)|Roundabout gene family]], which are well known to play a significant role in nervous system development. Also, LRRC24 was found to interact with LRRTM4, a protein believed to be involved in [[synaptogenesis]], as well as the maintenance of the nervous system in vertebrates.<ref name=":6" />


LRRC24 has also been found to interact with [[IGFBP7]], a known regulator of [[insulin-like growth factor]]s (IGFs).<ref name=":6" /> IGFBP7 is also involved in the stimulation of cell adhesion.
LRRC24 has also been found to interact with [[IGFBP7]], a known regulator of [[insulin-like growth factor]]s (IGFs).<ref name=":6" /> IGFBP7 is also involved in the stimulation of cell adhesion.

Revision as of 19:42, 4 August 2018

VALUE_ERROR (nil)
Identifiers
Aliases
External IDsGeneCards: [1]
Orthologs
SpeciesHumanMouse
Entrez

n/a

n/a

Ensembl

n/a

n/a

UniProt

n/a

n/a

RefSeq (mRNA)

n/a

n/a

RefSeq (protein)

n/a

n/a

Location (UCSC)n/an/a
PubMed searchn/an/a
Wikidata
View/Edit Human

Leucine rich repeat containing 24 is a protein that, in humans, is encoded by the LRRC24 gene.[1] The protein is represented by the official symbol LRRC24, and is alternatively known as LRRC14OS.[2] The function of LRRC24 is currently unknown. It is a member of the leucine-rich repeat (LRR) superfamily of proteins.

Gene

In humans, LRRC24 is located on Chromosome 8 (8q24.3). The gene spans approximately 4.66 kb on the opposite strand.[1] LRRC24 is composed of five exons, and only a single gene isoform has been identified.[1]

File:Genomic View for LRRC24 Gene.png
GeneCards Genomic View for LRRC24 gene[2]

Protein

General features

LRRC24 is a transmembrane protein of unknown function. Human LRRC24 consists of 513 amino acids including a 23 amino acid signal peptide.[1][3] The mature form of the protein has a molecular weight of 52.9 kDa.[4] The isoelectric point of the mature human protein is 7.98[5] The protein is largely composed of alpha helices.[6]

Domains

LRRC24 is a single-pass transmembrane protein. The protein consists of six leucine-rich repeats and an immunoglobulin-like domain.[1][7]

Feature Position(s) Description
Signal Peptide 1-23 [8]
Domain 24-50 Leucine rich repeat N-terminal domain (LRRNT)[9][10]
Repeat 51-72 Leucine rich repeat 1 (LRR 1)[9][10]
Repeat 75-96 LRR 2[9][10]
Repeat 99-120 LRR 3[9][10]
Repeat 123-144 LRR 4[9][10]
Repeat 147-168 LRR 5[9][10]
Repeat 171-192 LRR 6[9][10]
Domain 204-257 Leucine rich repeat C-terminal domain (LRRCT)[9][10]
Domain 259-364 Immunoglobulin-like domain (Ig-like)[9][10]
Domain 406-426 Transmembrane domain (TMEM)[11]
Motif 427-436 Arginine-rich motif (ARM)[9]
File:LRRC24 Protein Diagram.png
Diagram of LRRC24. Domains are labelled as predicted;[12] grey markers represent confirmed N-linked glycosylated arginine residues (N334 & N363); red marker represents confirmed phorphorylated tyrosine (Y509); Figure created using Prosite MyDomains-Image Creator[13]

Localization

LRRC24 is a secreted protein as is evidenced by the presence of a signal peptide. The structure of the protein suggests that it localizes to the cell membrane.

Homology

LRRC24 is conserved in Euteleostomi with the exception of Aves.[1][14] Also, based on sequence homology analysis, distant orthologs of LRRC24 are also conserved in invertebrates of phyla Mollusca and Arthropoda.[1] No human paralogs of LRRC24 have been identified.

File:LRRC24 Orthologs Unrooted Tree .png
An unrooted phylogenetic tree of LRRC24 orthologs generated using Phylip’s DrawTree[12] and ClustalW.[5][15]

Expression

Microarray and in situ hybridization experiments suggest LRRC24 is primarily expressed within the brain.[16][17][18] Expression is observed to be especially high within the midbrain, neocortex, and tissues of the limbic system, including the hypothalamus and hippocampal formation.[16][18][19]

Interactions

Protein-protein interactions of LRRC24 implicate the protein with cell signaling, cell migration, and axon guidance. ROBO2 was found to interact with LRRC24.[20][21] ROBO2 is a member of the Roundabout gene family, which are well known to play a significant role in nervous system development. Also, LRRC24 was found to interact with LRRTM4, a protein believed to be involved in synaptogenesis, as well as the maintenance of the nervous system in vertebrates.[21]

LRRC24 has also been found to interact with IGFBP7, a known regulator of insulin-like growth factors (IGFs).[21] IGFBP7 is also involved in the stimulation of cell adhesion.

Clinical significance

To date, no study has specifically implicated LRRC24 or the LRRC24 gene with any case of clinical significance.[22]

References

  1. ↑ 1.0 1.1 1.2 1.3 1.4 1.5 1.6 "LRRC24 leucine rich repeat containing 24 [Homo sapiens (human)] - Gene - NCBI". www.ncbi.nlm.nih.gov. Retrieved 2016-02-29.
  2. ↑ 2.0 2.1 "GeneCard". www.genecards.org. Retrieved 2016-05-09.
  3. ↑ "LRRC24 Gene (Protein Coding)". genecards.com. Retrieved February 22, 2016.
  4. ↑ Brendel V, Bucher P, Nourbakhsh IR, Blaisdell BE, Karlin S (March 1992). "Methods and algorithms for statistical analysis of protein sequences". Proceedings of the National Academy of Sciences of the United States of America. 89 (6): 2002–6. Bibcode:1992PNAS...89.2002B. doi:10.1073/pnas.89.6.2002. PMC 48584. PMID 1549558.
  5. ↑ 5.0 5.1 Kozlowski LP (October 2016). "IPC - Isoelectric Point Calculator". Biology Direct. 11 (1): 55. doi:10.1186/s13062-016-0159-9. PMC 5075173. PMID 27769290.
  6. ↑ Borrelli KW, Vitalis A, Alcantara R, Guallar V (November 2005). "PELE:  Protein Energy Landscape Exploration. A Novel Monte Carlo Based Technique". Journal of Chemical Theory and Computation. 1 (6): 1304–11. doi:10.1021/ct0501811. PMID 26631674.
  7. ↑ "LRRC24 - Leucine-rich repeat-containing protein 24 precursor - Homo sapiens (Human) - LRRC24 gene & protein". www.uniprot.org. Retrieved 2016-02-29.
  8. ↑ Petersen TN, Brunak S, von Heijne G, Nielsen H (September 2011). "SignalP 4.0: discriminating signal peptides from transmembrane regions". Nature Methods. 8 (10): 785–6. doi:10.1038/nmeth.1701. PMID 21959131.
  9. ↑ 9.0 9.1 9.2 9.3 9.4 9.5 9.6 9.7 9.8 9.9 "LRRC24 - Leucine-rich repeat-containing protein 24 precursor - Homo sapiens (Human) - LRRC24 gene & protein". www.uniprot.org. Retrieved 2016-05-09.
  10. ↑ 10.0 10.1 10.2 10.3 10.4 10.5 10.6 10.7 10.8 "NCBI Conserved Domain Search". www.ncbi.nlm.nih.gov. Retrieved 2016-05-09.
  11. ↑ Krogh A, Larsson B, von Heijne G, Sonnhammer EL (January 2001). "Predicting transmembrane protein topology with a hidden Markov model: application to complete genomes". Journal of Molecular Biology. 305 (3): 567–80. doi:10.1006/jmbi.2000.4315. PMID 11152613.
  12. ↑ 12.0 12.1 "LRRC24 leucine rich repeat containing 24 [Homo sapiens (human)] - Gene - NCBI". www.ncbi.nlm.nih.gov. Retrieved 2016-05-09.
  13. ↑ SIB Swiss Institute of Bioinformatics. "Prosite MyDomains - Image Creator".
  14. ↑ "HomoloGene - NCBI". www.ncbi.nlm.nih.gov. Retrieved 2016-05-09.
  15. ↑ Thompson JD, Higgins DG, Gibson TJ (November 1994). "CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice". Nucleic Acids Research. 22 (22): 4673–80. doi:10.1093/nar/22.22.4673. PMC 308517. PMID 7984417.
  16. ↑ 16.0 16.1 "GDS868 / GATCCATTGCTGAGCTTGCG". www.ncbi.nlm.nih.gov. Retrieved 2016-05-09.
  17. ↑ "GDS3142 / 1433876_at". www.ncbi.nlm.nih.gov. Retrieved 2016-05-09.
  18. ↑ 18.0 18.1 "GDS3917 / 1433876_at". www.ncbi.nlm.nih.gov. Retrieved 2016-05-09.
  19. ↑ "Experiment Detail :: Allen Brain Atlas: Mouse Brain". mouse.brain-map.org. Retrieved 2016-05-09.
  20. ↑ Gilsohn E, Volk T (2010-01-01). "Fine tuning cellular recognition: The function of the leucine rich repeat (LRR) trans-membrane protein, LRT, in muscle targeting to tendon cells". Cell Adhesion & Migration. 4 (3): 368–71. doi:10.4161/cam.4.3.11606. PMC 2958611. PMID 20404543.
  21. ↑ 21.0 21.1 21.2 Söllner C, Wright GJ (2009-01-01). "A cell surface interaction network of neural leucine-rich repeat receptors". Genome Biology. 10 (9): R99. doi:10.1186/gb-2009-10-9-r99. PMC 2768988. PMID 19765300.
  22. ↑ dbvar@ncbi.nlm.nih.gov. "Home - dbVar - NCBI". www.ncbi.nlm.nih.gov. Retrieved 2016-05-09.
Retrieved from "https://www.wikidoc.org/index.php?title=LRRC24&oldid=1523528"