Main public logs

Combined display of all available logs of wikidoc. You can narrow down the view by selecting a log type, the username (case-sensitive), or the affected page (also case-sensitive).

• 22:16, 23 February 2021 Marshallsumter talk contribs created page Serum response element gene transcriptions (Created page with "{{AE}} Henry A. Hoff The SRE wild type (SREwt) contains the nucleotide sequence ACAGGATGTCCATATTAGGACATCTGC, of which CCATATTAGG is the CArG box, TTAGGACAT is the C/EBP box,...")