SCAN domain

"The SCAN domain is a highly conserved, leucine-rich motif of approximately 60 aa originally found within a subfamily of zinc finger proteins."

"The SCAN domain (named after SRE-ZBP, CTfin51, AW-1 and Number 18 cDNA) is found in several pfam00096 proteins. The domain has been shown to be able to mediate homo- and hetero-oligomerization."

SRE-ZBP

The "SRE-ZBP [is] a human zinc finger protein that binds to the c-Fos serum response element (17)".

"The promoters of many genes whose transcription is rapidly and transiently induced following growth factor or mitogen stimulation of susceptible cells contain a common regulatory element, the serum response element (SRE)."

"The serum response element (SRE), a region of the c-fos gene which controls growth factor-induced transcription, is [...] shown to mediate c-fos transcription in response to activation of L-type voltage-sensitive calcium channels. Calcium-dependent transcriptional activation through the SRE is mediated by the serum response factor (SRF). Membrane depolarization induces phosphorylation of SRF at Ser-103, an event shown to enhance the ability of SRF to bind the SRE."

The SRE wild type (SREwt) contains the nucleotide sequence ACAGGATGTCCATATTAGGACATCTGC, of which CCATATTAGG is the CArG box, TTAGGACAT is the C/EBP box, and CATCTG is the E box.

"Less flexibility has been attributed to the backbone structure of Z-DNA than to B-DNA (Wang et al., 1979). Initially, Z-DNA was seen in crystal structures of molecules which have strict alternations of purines and pyrimidines involving GC and AT base pairs (Wang et al., 1979, 1984). However, it has recently been shown that Z-DNA will also form in the structure d(CGATCG) in which the cytosines are methylated or brominated on the C5 position (Wang et al., 1985) as well as the brominated d(CGCGATCGCG) (Feigon et al., 1985). In this non-alternating purine/pyrimidine sequence, the thymidines assume the syn conformation and the deoxyadenosines are in the anti conformation thereby preserving the dinucleotide repeat. The resulting deformations in the d(CGATCG) backbone are comparable in magnitude with those described above for a Z-DNA sequence having a wobble GT base pair. Thus, even though it is less flexible, the Z-DNA structure represents an energy minimum which can accommodate a number of modifications in base sequence and base pairing without major changes in the backbone conformation."

Gene ID: 81030 is ZBP1 Z-DNA binding protein 1. "This gene encodes a Z-DNA binding protein. The encoded protein plays a role in the innate immune response by binding to foreign DNA and inducing type-I interferon production. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene."

CTfin51

"This expression pattern in testis has been described for other C2H2-type zinc-finger proteins in mouse and human, like CTfin51, Zpf29, Sp1, and Zpf37."

Gene ID: 7589 is ZSCAN21 zinc finger and SCAN domain containing 21. Mouse ortholog is Gene ID: 22697 Zscan21 zinc finger and SCAN domain containing 21 also known as RU49; Zfp38; Zfp-38; Zipro1; CTfin51; AI326272.

AW-1

AW-1 is ZNF174.

Gene ID: 7727 is ZNF174 zinc finger protein 174. "This gene encodes a protein with three Cys2-His2-type zinc fingers in the carboxy-terminus, a putative nuclear localization signal, and an amino-terminus SCAN box which forms homodimers. This protein is believed to function as a transcriptional repressor. Alternative splicing results in multiple transcript variants encoding distinct isoforms." Aka AW-1 and zinc finger and SCAN domain-containing protein 8.

pfam00096 proteins

"The Pfam database is a large collection of protein families, each represented by multiple sequence alignments and hidden Markov models (HMMs)."

"Proteins are generally composed of one or more functional regions, commonly termed domains. Different combinations of domains give rise to the diverse range of proteins found in nature. The identification of domains that occur within proteins can therefore provide insights into their function."

"Pfam also generates higher-level groupings of related entries, known as clans. A clan is a collection of Pfam entries which are related by similarity of sequence, structure or profile-HMM."

"The data presented for each entry is based on the UniProt Reference Proteomes but information on individual UniProtKB sequences can still be found by entering the protein accession. Pfam full alignments are available from searching a variety of databases, either to provide different accessions (e.g. all UniProt and NCBI GI) or different levels of redundancy."

Family: zf-C2H2 (PF00096), "The C2H2 zinc finger is the classical zinc finger domain. The two conserved cysteines and histidines co-ordinate a zinc ion. The following pattern describes the zinc finger. #-X-C-X(1-5)-C-X3-#-X5-#-X2-H-X(3-6)-[H/C] Where X can be any amino acid, and numbers in brackets indicate the number of residues. The positions marked # are those that are important for the stable fold of the zinc finger. The final position can be either his or cys. The C2H2 zinc finger is composed of two short beta strands followed by an alpha helix. The amino terminal part of the helix binds the major groove in DNA binding zinc fingers. The accepted consensus binding sequence for Sp1 is usually defined by the asymmetric hexanucleotide core GGGCGG but this sequence does not include, among others, the GAG (=CTC) repeat that constitutes a high-affinity site for Sp1 binding to the wt1 promoter [2]."

See also

• Complex locus A1BG and ZNF497
• Serum response elements
• Serum response factor

External links

• The Pfam protein families database in 2019, S. El-Gebali, J. Mistry, A. Bateman, S.R. Eddy, A. Luciani, S.C. Potter, M. Qureshi, L.J. Richardson, G.A. Salazar, A. Smart, E.L.L. Sonnhammer, L. Hirsh, L. Paladin, D. Piovesan, S.C.E. Tosatto, R.D. Finn, Nucleic Acids Research (2019) doi: 10.1093/nar/gky995.