Alpha-1-B glycoprotein: Difference between revisions

Jump to navigation Jump to search
Line 210: Line 210:


The alpha-1-glycoprotein is upregulated 11-fold in the [[urine]] of patients who have [[steroid resistant nephrotic syndrome]].<ref name="Piyaphanee_2011">{{cite journal |vauthors=Piyaphanee N, Ma Q, Kremen O, Czech K, Greis K, Mitsnefes M, Devarajan P, Bennett MR | title = Discovery and initial validation of α 1-B glycoprotein fragmentation as a differential urinary biomarker in pediatric steroid-resistant nephrotic syndrome | journal = Proteomics: Clinical Applications | volume = 5 | issue = 5–6 | pages = 334–42 |date=June 2011 | pmid = 21591266 | doi = 10.1002/prca.201000110 }}</ref>  A1BG was present in 7/19 patients with SRNS and was absent from all patients with steroid sensitive nephrotic syndrome.<ref name="Piyaphanee_2011"/>  The 13.8 kDa A1BG fragment had a high discriminatory power for steroid resistance in pediatric nephrotic syndrome, but is only present in a subset of patients.<ref name="Piyaphanee_2011"/>
The alpha-1-glycoprotein is upregulated 11-fold in the [[urine]] of patients who have [[steroid resistant nephrotic syndrome]].<ref name="Piyaphanee_2011">{{cite journal |vauthors=Piyaphanee N, Ma Q, Kremen O, Czech K, Greis K, Mitsnefes M, Devarajan P, Bennett MR | title = Discovery and initial validation of α 1-B glycoprotein fragmentation as a differential urinary biomarker in pediatric steroid-resistant nephrotic syndrome | journal = Proteomics: Clinical Applications | volume = 5 | issue = 5–6 | pages = 334–42 |date=June 2011 | pmid = 21591266 | doi = 10.1002/prca.201000110 }}</ref>  A1BG was present in 7/19 patients with SRNS and was absent from all patients with steroid sensitive nephrotic syndrome.<ref name="Piyaphanee_2011"/>  The 13.8 kDa A1BG fragment had a high discriminatory power for steroid resistance in pediatric nephrotic syndrome, but is only present in a subset of patients.<ref name="Piyaphanee_2011"/>
===Proteomic studies of cancer types===
"Alpha-1B-glycoprotein is a secreted glycoprotein with some similarity to the immunoglobulin family and basically very few known functions<sup>70</sup>. [It] has been described in proteomic studies of several cancer types like breast cancer<sup>71</sup>, oral squamous carcinoma<sup>72</sup>, in the serum of non-small cell lung cancer<sup>73</sup>, and in pancreatic ductal adenocarcinoma<sup>74</sup>. Here we describe for the first time a negative correlation of alpha-1B-glycoprotein tissue expression to melanoma survival."<ref name=Betancourt>{{ cite journal
|author=Lazaro Hiram Betancourt, Krzysztof Pawłowski, Jonatan Eriksson, A. Marcell Szasz, Shamik Mitra, Indira Pla, Charlotte Welinder, Henrik Ekedahl, Per Broberg, Roger Appelqvist, Maria Yakovleva, Yutaka Sugihara, Kenichi Miharada, Christian Ingvar, Lotta Lundgren, Bo Baldetorp, Håkan Olsson, Melinda Rezeli, Elisabet Wieslander, Peter Horvatovich, Johan Malm, Göran Jönsson, and György Marko-Varga
|title=Improved survival prognostication of node-positive malignant melanoma patients utilizing shotgun proteomics guided by histopathological characterization and genomic data
|journal=Scientific Reports
|date=26 March 2019
|volume=9
|issue=
|pages=5154
|url=https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6435712/
|arxiv=
|bibcode=
|doi=10.1038/s41598-019-41625-z
|pmid=30914758
|accessdate=13 March 2020 }}</ref>


==See also==
==See also==

Revision as of 03:01, 14 March 2020

Associate Editor(s)-in-Chief: Henry A. Hoff

A1BG
Identifiers
AliasesA1BG, A1B, ABG, GAB, HYST2477, alpha-1-B glycoprotein
External IDsOMIM: 138670, MGI: 2152878, HomoloGene: 11167, GeneCards: A1BG
Gene location (Human)
Chromosome 19 (human)


Band19q13.43
Start58,345,178 bp
End58,353,492 bp
Genomic region: transcripts and products
Genomic region: transcripts and products (2010)
Genomic regions, transcripts, and products, indicating UTRs, introns, and exons
Orthologs
Species Human Mouse
Entrez 1 117586
Ensembl ENSG00000121410 ENSMUSG00000022347
UniProt P04217 Q19LI2
RefSeq (mRNA) NM_130786 NM_001081067
RefSeq (protein) NP_570602 NP_001074536
Location (UCSC) Chr 19: 58.35 – 58.35 Mb Chr 15: 60.9 – 60.92 Mb
PubMed search [1] [2]
VALUE_ERROR (nil)
Identifiers
Aliases
External IDsGeneCards: [3]
Orthologs
SpeciesHumanMouse
Entrez
Ensembl
UniProt
RefSeq (mRNA)

n/a

n/a

RefSeq (protein)

n/a

n/a

Location (UCSC)n/an/a
PubMed searchn/an/a
Wikidata
View/Edit Human

Alpha-1-B glycoprotein is a 54.3 kDa protein in humans that is encoded by the A1BG gene. [3] The protein encoded by this gene is a plasma glycoprotein of unknown function. The protein shows sequence similarity to the variable regions of some immunoglobulin supergene family member proteins. Patients who have pancreatic ductal adenocarcinoma show an overexpression of A1BG in pancreatic juice.[4]

Gene

Neighborhood

A1BG is located on the negative DNA strand of chromosome 19 from 58,858,172 – 58,864,865.[5] Additionally, A1BG is located directly adjacent to the ZSCAN22 gene (58,838,385-58,853,712)) on the positive DNA strand, as well as the ZNF837 (58,878,990 - 58,892,389, complement) and ZNF497 (58865723 - 58,874,214, complement) genes on the negative strand.[5]

Transcriptions

According to one source, A1BG is transcribed from the direction of ZNF497: 3' - 58864890: CGAGCCACCCCACCGCCCTCCCTTGG+1GGCCTCATTGCTGCAGACGCTCACCCCAGACACTCACTGCACCGGAGTGAGCGCGACCATCATG : 58866601-5',[6] where the second 'G' at left of four Gs in a row is the TSS.[7] Transcription was triggered in cell cultures and the transcription start site was found using reverse transcriptase. But, the mechanism for transcription is unknown.

Controlling the transcription of A1BG may have significant immune function against snake envenomation. A1BG forms a complex that is similar to those formed between toxins from snake venom and A1BG-like plasma proteins which inhibits the toxic effect of snake venom metalloproteinases or myotoxins and protects the animal from envenomation.[8]

Expression

A1BG is expressed at high levels in the adult and fetal liver.[9] Additionally, the mammary gland shows roughly half as much expression as the liver.[9] Trace amounts of A1BG expression can be found in the blood, brain, lung, lymph node, ovary, testis, pancreas, and pancreas.[9] Liver tumors exhibit elevated levels of A1BG transcripts.[9]

mRNA

mRNA structure

The gene contains 20 distinct introns.[10] Transcription produces 15 different mRNAs, 10 alternatively spliced variants and 5 unspliced forms.[10] There are 4 probable alternative promoters, 4 non overlapping alternative last exons and 7 validated alternative polyadenylation sites.[10] The mRNAs appear to differ by truncation of the 5' end, truncation of the 3' end, presence or absence of 4 cassette exons, overlapping exons with different boundaries, splicing versus retention of 3 introns.[10]

Protein

Properties

The San Diego Super Computer's Statistical Analysis of Protein (SAPS) program determined that alpha-1B glycoprotein has 495 amino acids residues, an isoelectric point of 5.47, and a molecular mass of 54.3 kDa. Additionally, it suggested that no transmembrane domains exist in alpha-1B glycoprotein.[11] According to NCBI, the amino acid sequence MLVVFLLLWGVTWGPVTEA is a signal peptide on the N-terminus of the protein that might function as an endoplasmic reticulum import signal.[11]

Post-translational modifications

The NetAcet 1.0 program calculated that the first five amino acid residues serve as an N-acetylation site.[12] The NetGlycate 1.0 program predicted that the lysines located at residue 78, 114, and 227 serve as glycation points.[13] The NetNES 1.1 program predicted the leucine at residue 47 to be a nuclear export signal.[14] The NetNGlyc 1.0 program predicted four N-glycosylation sites - two of which are highly conserved internally repeated sequences.[15][16] The NetCGlyc1.0 program predicted that none of the tryptophan residues serve as C-mannosylation sites.[17]

Protein interactions

A study by Udby et al. showed that Cysteine-rich secretory protein 3 is a ligand of alpha-1B glycoprotein in human plasma and they suggest that the A1BG-CRISP-3 complex displays a similar function in protecting the circulation from a potentially harmful effect of free CRISP-3.[18]

Homology

Orthologs

In addition to the table below, alpha-1B glycoprotein is also conserved in the white-cheeked crested gibbon, baboon, bolivian squirrel monkey, sheep, dog, wild boar, Chinese tree shrew, Chinese hamster, black flying fox, rabbit, guinea pig, giant panda, cow, rat, and the naked mole-rat.[19] Additionally, it is very likely that A1BG is further conserved throughout the mammalian clade.

Genus species Organism common name Divergence from humans (MYA) [20] NCBI protein accession number Sequence identity Protein length Common gene name
Homo sapiens[21] Humans -- NP_570602 100% 495 A1BG
Pan troglodytes[22] Common chimp 6.2 XP_001146669 97.0% 501 PREDICTED: Alpha-1B-glycoprotein isoform 4
Pan paniscus[23] Bonobo 6.3 XP_003816677 97.0% 499 A1BG
Gorilla gorilla gorilla [24] Gorilla 8.8 XP_004061652 95.0% 275 PREDICTED: alpha-1B-glycoprotein
Pongo abelii[25] Sumatran Organutan 15.7 XP_002829953 95.0% 495 alpha-1B-glycoprotein isoform 1
Macaca mulatta[26] Rhesus monkey 29.0 XM_001101821 88.0% 351 hypothetical protein EGK_11172, partial
Callithrix jacchus[27] Marmoset 42.6 XP_002762619 83.0% 500 A1BG
Mus musculus [28] Mouse 91.0 NP_001074536 44.0% 512 alpha-1B-glycoprotein precursor
Felis catus[29] Cat 94.2 XP_003997399 62.0% 481 PREDICTED: alpha-1B-glycoprotein
Equus caballus[30] Horse 97.4 XP_001495344 58.0% 568 PREDICTED: alpha-1B-glycoprotein-like
Loxodonta africana [31] African bush elephant 104.7 XP_003406722 61.0% 520 PREDICTED: alpha-1B-glycoprotein-like

Paralogs

No paralogs have been found for alpha-1B glycoprotein.[32]

Homologous domains

An initial NCBI Blast alignment of alpha-1B glycoprotein illustrates that the protein is mainly composed of three immunoglobulin domains.[33] There is a large segment of amino acids from position 297 to 400 that is not shown to be an immunoglobulin domain. However, a NCBI BLAST alignment of just the amino acids from 297-400 does illustrate that the latter sequence is indeed a fourth immunoglobulin domain.[34] Ultimately, alpha-1B glycoprotein seems to be primarily composed of four immunoglobulin domains.

Clinical significance

Steroid-resistant nephrotic syndrome

The alpha-1-glycoprotein is upregulated 11-fold in the urine of patients who have steroid resistant nephrotic syndrome.[35] A1BG was present in 7/19 patients with SRNS and was absent from all patients with steroid sensitive nephrotic syndrome.[35] The 13.8 kDa A1BG fragment had a high discriminatory power for steroid resistance in pediatric nephrotic syndrome, but is only present in a subset of patients.[35]

Proteomic studies of cancer types

"Alpha-1B-glycoprotein is a secreted glycoprotein with some similarity to the immunoglobulin family and basically very few known functions70. [It] has been described in proteomic studies of several cancer types like breast cancer71, oral squamous carcinoma72, in the serum of non-small cell lung cancer73, and in pancreatic ductal adenocarcinoma74. Here we describe for the first time a negative correlation of alpha-1B-glycoprotein tissue expression to melanoma survival."[36]

See also

References

  1. [1]
  2. [2]
  3. "Entrez Gene: Alpha-1-B glycoprotein". Retrieved 2012-11-09.
  4. Tian M, Cui YZ, Song GH, Zong MJ, Zhou XY, Chen Y, Han JX (2008). "Proteomic analysis identifies MMP-9, DJ-1 and A1BG as overexpressed proteins in pancreatic juice from pancreatic ductal adenocarcinoma patients". BMC Cancer. 8: 241. doi:10.1186/1471-2407-8-241. PMC 2528014. PMID 18706098.
  5. 5.0 5.1 "A1BG alpha-1-B glycoprotein". Retrieved May 10, 2013.
  6. Michael David Winther, Leah Christine Knickle, Martin Haardt, Stephen John Allen, Andre Ponton, Roberto Justo De Antueno, Kenneth Jenkins, Solomon O. Nwaka, Y. Paul Goldberg (July 29, 2004). Fat Regulated Genes, Uses Thereof and Compounds for Mudulating Same. US Patent Office. Retrieved 2013-02-14.
  7. HGNC (February 5, 2013). A1BG alpha-1-B glycoprotein [ Homo sapiens ]. 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information, U.S. National Library of Medicine. Retrieved 2013-02-14.
  8. Udby L, Sørensen OE, Pass J, Johnsen AH, Behrendt N, Borregaard N, Kjeldsen L. (October 2004). "Cysteine-rich secretory protein 3 is a ligand of alpha1B-glycoprotein in human plasma". Biochemistry. 43 (40): 12877–86. doi:10.1021/bi048823e. PMID 15461460. |access-date= requires |url= (help)
  9. 9.0 9.1 9.2 9.3 "EST Profile - Hs.529161". UniGene. National Center for Biotechnology Information, U.S. National Library of Medicine. Retrieved 2013-05-11.
  10. 10.0 10.1 10.2 10.3 "AceView: A1BG". Retrieved May 11, 2013.
  11. 11.0 11.1 Brendel V, Bucher P, Nourbakhsh IR, Blaisdell BE, Karlin S (March 1992). "Methods and algorithms for statistical analysis of protein sequences". Proc. Natl. Acad. Sci. U.S.A. 89 (6): 2002–6. doi:10.1073/pnas.89.6.2002. PMC 48584. PMID 1549558.
  12. Kiemer L, Bendtsen JD, Blom N (April 2005). "NetAcet: prediction of N-terminal acetylation sites". Bioinformatics. 21 (7): 1269–70. doi:10.1093/bioinformatics/bti130. PMID 15539450.
  13. Johansen MB, Kiemer L, Brunak S (September 2006). "Analysis and prediction of mammalian protein glycation". Glycobiology. 16 (9): 844–53. doi:10.1093/glycob/cwl009. PMID 16762979.
  14. la Cour T, Kiemer L, Mølgaard A, Gupta R, Skriver K, Brunak S (June 2004). "Analysis and prediction of leucine-rich nuclear export signals". Protein Eng. Des. Sel. 17 (6): 527–36. doi:10.1093/protein/gzh062. PMID 15314210. Retrieved May 10, 2013.
  15. Gupta, R. "Prediction of N-glycosylation sites in human proteins". Retrieved May 10, 2013.
  16. Higgins DG, Bleasby AJ, Fuchs R (April 1992). "CLUSTAL V: improved software for multiple sequence alignment". Comput. Appl. Biosci. 8 (2): 189–91. doi:10.1093/bioinformatics/8.2.189. PMID 1591615.
  17. Julenius, Karin (2007). "NetCGlyc1.0: Prediction of mammalian C-mannosylation sites". Glycobiology. 17: 868–876. doi:10.1093/glycob/cwm050. PMID 17494086. Retrieved May 10, 2013.
  18. Udby L, Sørensen OE, Pass J, Johnsen AH, Behrendt N, Borregaard N, Kjeldsen L (October 2004). "Cysteine-rich secretory protein 3 is a ligand of alpha1B-glycoprotein in human plasma". Biochemistry. 43 (40): 12877–86. doi:10.1021/bi048823e. PMID 15461460.
  19. "NCBI Blast results for A1BG protein sequence". Retrieved May 11, 2013.
  20. "Time Tree".
  21. "alpha-1-B glycoprotein [Homo sapiens]". Retrieved May 11, 2013.
  22. "PREDICTED: alpha-1B-glycoprotein isoform 4 [Pan troglodytes]". NCBI. Retrieved May 10, 2013.
  23. "PREDICTED: alpha-1B-glycoprotein [Pan paniscus]". Retrieved May 11, 2013.
  24. "PREDICTED: alpha-1B-glycoprotein". Retrieved May 10, 2013.
  25. "Send to: PREDICTED: alpha-1B-glycoprotein isoform 1 [Pongo abelii]". Retrieved May 11, 2013.
  26. "hypothetical protein EGK_11172, partial [Macaca mulatta]". Retrieved May 11, 2013.
  27. "PREDICTED: alpha-1B-glycoprotein [Callithrix jacchus]". Retrieved May 11, 2013.
  28. "alpha-1B-glycoprotein precursor [Mus musculus]". Retrieved May 11, 2013.
  29. "PREDICTED: alpha-1B-glycoprotein [Felis catus]". Retrieved May 11, 2013.
  30. "PREDICTED: alpha-1B-glycoprotein-like". Retrieved May 11, 2013.
  31. "PREDICTED: alpha-1B-glycoprotein-like [Loxodonta africana]".
  32. "A1BG Gene". Weissman Institute of Science. Retrieved May 10, 2013.
  33. "NCBI conserved domain search". Retrieved May 10, 2013.
  34. "NCBI Blast: Protein Sequence". Retrieved May 10, 2013.
  35. 35.0 35.1 35.2 Piyaphanee N, Ma Q, Kremen O, Czech K, Greis K, Mitsnefes M, Devarajan P, Bennett MR (June 2011). "Discovery and initial validation of α 1-B glycoprotein fragmentation as a differential urinary biomarker in pediatric steroid-resistant nephrotic syndrome". Proteomics: Clinical Applications. 5 (5–6): 334–42. doi:10.1002/prca.201000110. PMID 21591266.
  36. Lazaro Hiram Betancourt, Krzysztof Pawłowski, Jonatan Eriksson, A. Marcell Szasz, Shamik Mitra, Indira Pla, Charlotte Welinder, Henrik Ekedahl, Per Broberg, Roger Appelqvist, Maria Yakovleva, Yutaka Sugihara, Kenichi Miharada, Christian Ingvar, Lotta Lundgren, Bo Baldetorp, Håkan Olsson, Melinda Rezeli, Elisabet Wieslander, Peter Horvatovich, Johan Malm, Göran Jönsson, and György Marko-Varga (26 March 2019). "Improved survival prognostication of node-positive malignant melanoma patients utilizing shotgun proteomics guided by histopathological characterization and genomic data". Scientific Reports. 9: 5154. doi:10.1038/s41598-019-41625-z. PMID 30914758. Retrieved 13 March 2020.

External links