Serum response elements: Difference between revisions
Created page with "{{AE}} Henry A. Hoff "The serum response element (SRE), a region of the c-''fos'' gene which controls growth factor-induced transcription, is [...] shown to mediate c-''fos''..." |
m Marshallsumter moved page Serum response element to Serum response elements: Renaming:There are more than one elements involved. |
(No difference)
|
Revision as of 21:29, 7 December 2019
Associate Editor(s)-in-Chief: Henry A. Hoff
"The serum response element (SRE), a region of the c-fos gene which controls growth factor-induced transcription, is [...] shown to mediate c-fos transcription in response to activation of L-type voltage-sensitive calcium channels. Calcium-dependent transcriptional activation through the SRE is mediated by the serum response factor (SRF). Membrane depolarization induces phosphorylation of SRF at Ser-103, an event shown to enhance the ability of SRF to bind the SRE."[1]
The SRE wild type (SREwt) contains the nucleotide sequence ACAGGATGTCCATATTAGGACATCTGC, of which CCATATTAGG is the CArG box, TTAGGACAT is the C/EBP box, and CATCTG is the E box.[1]
Acknowledgements
The content on this page was first contributed by: Henry A. Hoff.
Initial content for this page in some instances came from Wikiversity.
See also
References
- ↑ 1.0 1.1 Ravi P. Misra, Azad Bonni, Cindy K. Miranti, Victor M. Rivera, Morgan Sheng, and Michael E.Greenberg (14 October 1994). "L-type Voltage-sensitive Calcium Channel Activation Stimulates Gene Expression by a Serum Response Factor-dependent Pathway" (PDF). The Journal of Biological Chemistry. 269 (41): 25483–25493. Retrieved 7 December 2019.CS1 maint: Multiple names: authors list (link)