A1BG response element gene transcriptions: Difference between revisions

Revision as of 00:28, 25 February 2021

Associate Editor(s)-in-Chief: Henry A. Hoff

Def. nucleotide "sequences, usually upstream, which are recognized by specific regulatory transcription factors, thereby causing gene response to various regulatory agents", [that] "may be found in both promoter and enhancer regions"^[1] are called response elements.

Hypotheses

A1BG has no response elements in either promoter.
A1BG is not transcribed by a response element.
Each response element does not participate in the transcription of A1BG.

Response element testing

Response element
Name of elements	Consensus sequences	Testing	Notes
Abbreviations	variations	Present (Y), Absent (N)
Authors
1. ABA responsive elements (ABREs)	ACGTG(G/T)C	Y	-
2. novel ABA-response elements (ABREN, novel ABRE)	GATCGATC, CGATCGAT, GATCGAT	N	ABREN, CGATCGAT motif, and core of ABREN and CGATCGAT motif.^[2]
3. ABA-response element-like (ABRE-like)	ACGTGTCC	N	third highest scoring motif^[2]
4. Activated B-cell Factor-1s (ABFs)	CGTNNNNN(A/G)(C/T)GA(C/T)	Y	-
5. Abf1 regulatory factors	CGTCCTCTACGAT	N	CGTNNNNNACGAT^[3]
6. A boxes	TACGTA	Y	-
7. boxes A	TGACTCT	Y	-
9. Abscisic acid-responsive elements (Pho4s), G boxes	CACGTG^[4]	Y	-
10. ACGT-containing elements	ACGT	Y	-
11. Activating protein 2 (AP2) (Cohen)	GCCTGGCC	Y	-
12. Activating protein 2 (Cohen)	TCCCCCGCCC	Y	-
13. Activating protein 2 (Murata)	(C/G)CCN(3,4)GG(C/G)	Y	-
14. Activating proteins (Murata)	GCCCACGGG	N	Activating protein 2^[5]
15. Activating protein 2 (Yao)	TCTTCCC	Y	-
16. Activating protein 2 (Yao)	CTCCCA	Y	-
17. Activating proteins (AP-2) (Yao)	GGCCAA	N	Activating protein 2 (AP-2)^[6]
18. AhR-responsive elements (AHRE) (Yao)	(G/T)NGCGTG(A/C)(C/G)A	N	in the promoter region of AhR responsive genes
19. Activating transcription factors (Burton)	(A/C/G)TT(A/G/T)C(A/G)TCA	Y	-
20. Activating transcription factors (Kilberg)	(A/G/T)TT(A/G/T)CATCA	Y	-
21. Adr1ps	TTGG(A/G)G	Y	-
22. Aft1s	(C/T)(A/G)CACCC(A/G)	Y	-
23. AGC boxes	AGCCGCC	Y	-
24. AhR responsive element (AHRE-II)	CATGN₆C(A/T)TG	Y	-
25. Alpha-amylase conserved elements	TATCCA	N	TATCCATCCATCC^[7]
26. Amino acid response elements (AARE) (Maruyama)	ATTGCATCA	N	AARE1 (ATTGCATCA)^[8]
27. Amino acid response elements (AARE) (Broer)	TTTGCATCA	N	TTTGCATCA.^[9]^[10]
28. Amino acid response element-like (AARE-like)	TGGTGAAAG	N	AARE-like sequence (TGGTGAAAG, named AARE3)^[8]
29. Androgen response elements (AREs) (Kouhpayeh)	GGTACANNNTGTTCT^[11]	N	GGTACACGGTGTTCT^[11]
30. Androgen response elements (Kouhpayeh)	GGTACAnnnTGTTCT	Y	Positive strand: TGTTCT at 45, Negative strand: TGTTCT at 108 Positive strand: GGTACA at 3901, GGTACA at 3336, GGTACA at 2474
31. Androgen response elements (Wilson)	AGAACANNNTGTTCT^[12]	Y	Negative strand: TGTTCT at 3759, TGTTCT at 3635, TGTTCT at 3340, TGTTCT at 3307; AGAACA at 4068, AGAACA at 3094, TGTTCT at 108, AGAACA at 281 Positive strand: AGAACA at 3668, AGAACA at 287, TGTTCT at 45
32. Androgen response elements (AREs) (Wilson)	TGATTCGTGAG	N	AGAACANNNTGTTCT^[12]
33. Antioxidant-electrophile responsive elements (Lacher)	GC(A/C/T)(A/G/T)(A/G/T)(C/G/T)T(A/C)A	Y	-
34. Antioxidant-electrophile responsive elements (Otsuki)	GTGAGGTCGC	N	GTGAGGTCGC^[13] or GCTGAGT, GCAGGCT of GC(A/C/T)(A/G/T)(A/G/T)(C/G/T)T(A/C)A^[14], an antioxidant response element (ARE)
35. ATA boxes	AATAAA	Y	-
36. Auxin response factors (Ulmasov)	TGTCTC	Y	-
37. Auxin response factors (Boer)	TGTCGG	Y	-
38. B-boxes (Johnson)	TGGGCA	Y	-
39. boxes B (Sanchez)	TGTCTCA	Y	-
40. B recognition elements (BRE^u)	(G/C)(G/C)(G/A)CGCC	Y	-
41. CAAT boxes	(C/T)(A/G)(A/G)CCAATC(A/G)	N	consensus sequence for the CCAAT-enhancer-binding site (C/EBP) is TAGCATT
42. CadC binding domains	TTANNNNT	Y	-
43. Calcineurin-responsive transcription factors	TG(A/C)GCCNC	Y	-
44. Calcium-response elements	CTATTTCGAG	N	CaRE1 CTATTTCGAG^[15]
45. Carbohydrate response elements (ChREs)	CACGTGACCGGATCTTG, TCCGCCCCCATCACGTG	N	ChoRE1, ChoRE2^[16]
46. Carbohydrate response elements	ChoRE1 ACCGG, ChoRE2 CCCAT	Y	-
47. CAACTC regulatory elements (CAREs)	CAACTC	Y	-
48. CArG boxes	CCAAAAAT(G/A)G	Y	-
49. Cat8ps	CGG(A/C/G/T)(C/G/T)(A/C/G/T)(A/C/G)(A/C)(A/C/T)GGA	Y	-
50. CAT boxes	CATTCCT	Y	-
51. Cbf1 regulatory factors	TCACGTGA	N	strongly bound Cbf1 motifs enriched at both ends with a "T" on the 5′ and "A" on the 3′ end
52. C-boxes (Johnson)	GAGGCCATCT	N	GAGGCCATCT^[17]
53. C boxes (Samarsky)	AGTAGT	Y	-
54. C-boxes (Song)	GACGTC	Y	-
55. C/A hybrid boxes	TGACGTAT	N	TGACGTAT^[18] A at the 12 position
56. hybrid C/G-boxes (Song)	TGACGTGT	Y	-
57. C/T hybrid boxes	TGACGTTA	N	TGACGTTA^[18] T at the 12 position
58. C boxes (Voronina)	GGTGATG	Y	-
59. CCAAT-boxes-binding transcription factors (Hap4p)	CCAAT	Y	-
60. CCCTC-binding factors (CTCF)	NCA-NNA-G(A/G)N-GGC-(A/G)(C/G)(C/T)	N	NCA-NNA-G(G/A)N-GGC-(G/A)(C/G)(T/C)^[19]
61. C/EBP boxes	TTAGGACAT,^[20] or TAGCATT^[6]	N	CCAAT-enhancer-binding site (C/EBP) is TAGCATT
62. Cell cycle regulation	CCCAACGGT^[7]	N	tomato genome-wide analysis
63. CENP-B boxes	TTTCGTTGGAAGCGGGA	N	specifically localized at the centromere
64. CGCG boxes	(A/C/G)CGCG(C/G/T)	Y	-
65. Coupling elements (CE)	TGCCACCGG^[2]	N	CE1 (Watanabe)
66. Circadian control elements	CAANNNNATC	Y	-
67. Cold-responsive elements	CCGAC	Y	-
68. Coupling elements (CE1s) (Watanabe)	GCGTGTC	Y	-
69. Coupling elements (CE3s) (Ding)	CACGCG	Y	-
70. cAMP-responsive elements (CREs), Aca1ps, Sko1ps	TGACGTCA	Y	-
71. DAF-16 binding elements	(A/G)(C/T)AAA(C/T)A	Y	-
72. DAF-16-associated elements (DAE)	TGATAAG	N	DAF-16-associated element (DAE)^[21]
73. D-boxes (Mracek1)	GTTGTATAAC	N	GTTGTATAAC^[22]
74. D-boxes (Mracek)	CTTATGTAAA (Mracek2)	N	CTTATGTAAA^[22]
75. D-boxes (Johnson)	TCTCACA	N	TCTCACATT(A/C)AATAAGTCA is a D-box.^[17]
76. D boxes (Samarsky)	AGTCTG	Y	-
77. D boxes (Voronina)	TCCTG	Y	-
78. D-boxes (Motojima)	TGAGTGG	Y	-
79. Dioxin-responsive elements (DREs)	TNGCGTG	Y	-
80. Defense and stress-responsive elements	ATTTTCTTCA	N	(ATTTTCTTCA)^[7]
81. DNA damage response elements (DREs) (Smith)	TTTCAAT^[23]	N	in the upstream repression sequence (URS)
82. DNA damage response elements (DRE, core) (Sumrada)	CCGCC	Y	-
83. DNA damage response elements (DREs) (Sumrada)	TAGCCGCCG of TAGCCGCCGRRRR^[24]	N	in the upstream repression sequence (URS)
84. DNA replication-related elements (DREs)	TATCGATA	N	DNA replication-related element (DRE)^[25]
85. Downstream B recognition elements	(A/G)T(A/G/T)(G/T)(G/T)(G/T)(G/T)	Y	-
86. Downstream core elements (DCEs)	CTTC...CTGT...AGC	Y	-
87. Downstream promoter elements (DPEs)	(A/G)G(A/T)(C/T)(A/C/G)T	Y	-
88. DREB boxes	TACCGACAT	N	CRT/DREB box
89. E2 boxes	(G/A)CAG(A/C/G/T)TG(A/C/G/T)	Y	-
90. EIF4E basal elements	TTACCCCCCCTT	N	poly(C) motif
91. EIN3 binding sites	A(C/T)G(A/T)A(C/T)CT	Y	-
92. Endoplasmic reticulum stress response elements (ERSE)	CCAAT	N	CCAATGGGCTGAAAC between ZNF497 and A1BG, compare CCAAT-box and ERSE below
93. Endoplasmic reticulum stress response elements	CCAAT-N9-CCACG, CCACG	Y	-
94. Endosperm expressions	TGTGTCA	Y	-
95. Enhancer boxes	CA(A/C/G/T)(A/C/G/T)TG	Y	-
96. Estrogen response elements (EREs)	AGGTTA or GGTCAGGAT	N	AGGTTATTGCCTCCT or GGTCAGGATGAC
97. Ethylene responsive elements	ATTTCAAA	Y	-
98. F boxes	TGATAAG^[26]	N	F-box overlaps the I-box
99. Forkhead boxes	GTAAACAA^[27]	N	GTAAACAA FOXO1
100. Forkhead boxes	(A/G)(C/T)AAA(C/T)A	Y	-
101. GAAC elements	GAACT	Y	-
102. Gal4ps	CGGACCGC	N	CGG(A/G)NN(A/G)C(C/T)N(C/T)NCNCCG^[28]
103. γ-interferon activated sequences (GAS)	TTCCTAGAA	N	ALS-GAS1 between nt −633 and nt −625
104. Γ-interferon activated sequences (GAS), see STAT5	TTNCNNNAA	Y	-
105. GATA boxes	GATA	Y	-
106. G boxes	(G/T)CCACGTG(G/T)C	N	no "perfect palindrome" G boxes in either promoter
107. GC boxes	(G/T)(G/A)GGCG(G/T)(G/A)(G/A)(C/T)	Y	-
108. GCC boxes	GCCGCC	Y	-
109. General control nonderepressible 4 protein binding site (GCRE, GCN4)	TGA(C/G/T)T(A/C/G)(A/T)	Y	-
110. GCN4 motifs	TGACTCA, TGAGTCA	N	ACGT motif
111. Gcn4ps	ATGACTCTT^[28]	N	GCN4 motifs
112. Gibberellic acid responsive elements (GAREs)	TAACAAA	Y	-
113. Gibberellin responsive elements (GAREs) (Sharma)	AAACAGA^[7]	Y	-
114. GARE-like 1 (Fan)	TAACA(A/G)A^[29]	Y	-
115. Gibberellin responsive element-like 2 (GARE-like 2) (Fan)	TAACGTA^[29]	N	"in the promoters of hydrolase genes".^[29]
116. GLM boxes	(G/A)TGA(G/C)TCA(T/C)	N	GCN4-like motif
117. G-protein-coupled receptors (GCR1s), CT boxes	CTTCC	Y	-
118. Glucocorticoid response elements	AGAACA	Y	-
119. Grainy head transcription factor binding sites	AACCGGTT	N	also GACTGGTT
120. GT boxes (Motojima)	TGGGTGGGGCT	N	(-78 to -69)
121. GT boxes (Sato)	GGGG(T/A)GGGG	Y	Negative strand, Positive direction: GGGGAGGGG at 2291
122. Hac1 KAR2	CAGCGTG	Y	Positive strand, negative direction: CAGCGTG at 740, Negative strand, positive direction: CACGCTG at 778
123. H and ACA boxes	AGAGGA	Y	-
124. Hapless motifs	CCAATCA	N	heterotrimeric transcription factor, HAP2/3/4.^[30]
125. H boxes (Lindsay)	CCTACC	Y	-
126. H box (Mitchell)	ANANNA	Y	-
127. H box (Rozhdestvensky)	ACACCA	Y	-
128. Heat-responsive elements	AAAAAATTTC	N	four nGAAn motifs
129. Heat shock elements (HSEs) (Eastmond)	nGAAn-(5-bp)-nGAAnnTTCn	Y	Negative strand, positive direction: GGAATTCACATGAACCTTCA at 332
130. Heat shock elements (HSEs) (Eastmond)	nGA(A/G)n-(5-bp)-nGAAnnTTCn (GAP)	Y	Negative strand, positive direction: GGAATTCACATGAACCTTCA at 332
131. Heat shock elements (HSEs) (Eastmond)	nGAAn-(5-bp)-nGA(A/G)nnTTCn (GAP)	Y	Negative strand, negative direction: GGAATTCACATGAACCTTCA at 332
132. Heat shock elements (HSEs) (Eastmond)	nGAAn-(5-bp)-nGAAn-(5-bp)-nGAAn	Y	Postive strand, negative direction: AGAAGAAAAAAGAAAAGAGAAGAAA at 2831
133. Heat shock elements (HSE1) (Eastmond)	nGAAnnTTCnnGAAn	N	HSE1
134. Heat shock elements (HSE2) (Eastmond)	nTTCnnGAAnnTTCn	N	HSE2 is the inverse complement of HSE1
135. Heat shock elements (HSE5) (Eastmond)	nTTCn-(5-bp)-nTTCnnGAAn	N	HSE5
136. Heat shock elements (HSE6) (Eastmond)	nTTCn-nnGAAn-(5-bp)-nGAAn	N	HSE6
137. Heat shock elements (HSE7) (Eastmond)	nGA(A/G)nnTTCnnGAAn	N	HSE7 PFT1
138. Heat shock elements (HSE) (Eastmond)	nGAAnnTTCnnGA(A/G)n	N	HSE7 PFT2
139. Heat shock elements (HSE10) (Eastmond)	nTTCn-(11-bp)-nGAAn-(5 bp)-nGAAn	N	HSE10
140. Hex sequences	TGACGTGGC	Y	Positive strand, positive direction: TGACGTGGC at 4344
141. High Mobility Group boxes (HMG boxes)	(A/T)(A/T)CAAAG	Y	Positive strand, negative direction: ATCAAAG at 2891
142. HNF6s	(A/G/T)(A/T)(A/G)T(C/T)(A/C/G)AT(A/C/G/T)(A/G/T)	Y	Positive strand, negative direction: TTATTAATTC at 4542, TTATTAATCG at 4229, TAGTTGATAA at 3527
143. Homeoboxes	CAAG	Y	-
144. HY boxes	TG(A/T)GGG	Y	Negative strand, negative direction: CCCTCA at 4498, CCCTCA at 3889, CCCACA at 3184 Positive strand, negative direction: TGAGGG at 4558, TGTGGG at 3712, TGAGGG at 3652
145. Hypoxia-inducible factors	GCCCTACGTGCTGTCTCA^[31]	N	composed of HIF-1α and HIF-1β
146. Hypoxia response elements	ACGTG	Y	Negative strand: ACGTG at 4339, CACGT at 3429, ACGTG at 3288, CACGT at 2863 Positive strand: ACGTG at 4237
147. I boxes	GATAAG	N	GGATGAGATAAGA
148. Initiator elements (Inrs)	YYANWYY	Y	Negative strand, negative direction: TTACTCC at 4557, TCACACT at 4361, TCGGACC at 4349, CCAGTTT at 4309, TCGGACC at 4300, GGTCCGA at 4255, CTGCACC at 4238, TCGGTCT at 4233 Positive strand, negative direction: GGAATGA at 4555, TTAATTC at 4542, TCACATT at 4533, AGTCCAA at 4502, CCACTTT at 4461, CCACTCC at 4425, CCACTCC at 4425, CCAGTTC at 4417, AGTGTGA at 4361, CTGCACT at 4340, CCGGACT at 4327, AAAATAA at 4221
149. Initiator elements (Inrs)	BBCABW	Y	Negative strand, negative direction: TCTGGG at 4366, GTCACA at 4359, CCCACT at 4353, TGTGAC at 4336, GTCACT at 4319, TCCAGT at 4307, TCTGCA at 4236 Positive strand, negative direction: AATGAG at 4556, TTCACA at 4531, CCCACT at 4485, TCCACT at 4459, CCCAGA at 4448, TCCACT at 4423, GCCAGT at 4415, TGCACT at 4340, TGCAGT at 4317, GCCAGA at 4233
150. Initiator-like elements	TTCTCT	Y	Negative strand: AGAGAA at 4527, TTCTCT at 3380
151. Inositol/choline-responsive elements (ICRE) (Case)	CANNTGAAAT	N	version of Lopes, see below
152. Inositol/choline-responsive elements (ICRE) (Case, Lopes)	CATGTGAAAT includes the canonical basic helix-loop-helix (bHLH) binding site CANNTG (Lopes et al. 1991)	Y	-
153. Inositol/choline-responsive elements (ICRE) (Lopes)	ATGTGAAAT	N	using ANNTGAAAT
154. Inositol/choline-responsive elements (ICREs) (Schwank)	TYTTCACATGY contains the core sequence CANNTG	Y	-
155. Interferon regulatory factor (IFF3)	GCTTTCC	Y	-
156. Jasmonic acid-responsive elements (JAREs)	TGACG	Y	-
157. Kozak sequences	GCCGCC(A/G)CCATGG	N	GCCGCC(A/G)CCATGG^[32]
158. Kozak sequences (Matsumoto)	GAAAATGG	N	GAAAATGG^[33]
159. Krüppel-like factors	GGGNN(G/T)(G/T)(G/T)	Y	-
160. L boxes	AAATTAACCAA	N	AAATTAACCAA^[34]
161. -35 sequence	TTGACA	Y	Negative strand: TTGACA at 4399
162. Maf recognition element (MAREs)	TGCTGA(G/C)TCAGCA	N	and TGCTGA(GC/CG)TCAGCA^[35]
163. M boxes	GTCATGTGCT	N	or AGTCATGTGCT^[36]
164. Mcm1 regulatory factors	TT(A/T)CCNN(A/T)TNGG(A/T)AA	N	Primary consensus sequence apparently: TT(A/T)CCNN(A/T)TNGG(A/T)AA.^[3]
165. Met31ps	AAACTGTG^[37]	Y	Positive strand, negative direction: AAACTGTG at 4400
166. Metal responsive elements (MRE)	TGC(A/G)C(A/C/G/T)C	Y	Positive strand: TGCACTC at 4341, TGCACTC at 3290, GTGTGCA at 2863
167. Middle sporulation element (MSE) (Branco)	ACACAAA	Y	Negative strand, negative direction: TTTGTGT at 3513
168. Midsporulation element (MSE) (Ozsarac)	C(A/G)CAAA(A/T)	Y	Negative strand, negative direction: TTTTGTG at 3512 Positive strand, negative direction: CACAAAA at 3767
169. Multicopy inhibitor of the GAL1 promoter (MIG1)	(C/G)(C/T)GGGG	Y	Negative strand, negative direction: GTGGGG at 4445, GTGGGG at 3058 Positive strand, negative direction: CCCCAG at 4447, CTGGGG at 3037
170. Motif ten elements	C(C/G)A(A/G)C(C/G)(C/G)AACG(C/G)	N	Gene ID: 6309
171. Myeloblastosis recognition element (MRE)	A(A/C)C(A/T)A(A/C)C	Y	Negative strand: GGTAGGT at 4457, ACCAACC at 3946, ACCAACC at 3606, GGTTGTT at 3139
172. Myocyte enhancer factors (MEFs)	(C/T)TA(A/T)(A/T)(A/T)(A/T)TA(A/G)	Y	Negative strand, negative direction: TTATTATTAA at 4226
173. Non-DiTyrosine 80 transcription factor DNA binding domain (Ndt80)	(A/G/T)NC(A/G)CAAA(A/T)	Y	Negative strand, negative direction: TTTTGTGTT at 3514 Positive strand: ACCACAAAA at 3767
174. NF‐κB/Rel family of eukaryotic transcription factors	CCCCTAAGGGG	N	NF-κB
175. Nuclear factor 1 (NF-1)	TTGGCNNNNNGCCAA	N	palindromic sequence
176. Nuclear factor of activated T cells (NFATs)	GGAAAA	Y	Negative strand, negative direction: TTTTCC at 3441, TTTTCC at 3345 Positive strand, negative direction: GGAAAA at 2968, GGAAAA at 2927
177. Nuclear factor Ys	CCAATGG(A/C)(A/G)	N	NF-Y is a trimeric complex
178. Nutrient-sensing response element 1	GTTTCATCA	Y	-
179. Oaf1 transcription factor	CGGN₃TNAN_9-12CCG	Y	-
180. ORESARA1 (ORE1) (Matallana)	(A/C/G)(A/C)GT(A/G)N_5,6(C/T)AC(A/G)	Y	Negative strand, negative direction: GCGTAGAAGACACA at 3558, AAGTAGTTTCTACG at 2895
181. ORESARA1 (ORE1) (Olsen)	T(A/G/T)(A/G)CGT(A/G)(A/C/T)(A/G/T)	Y	Negative strand, negative direction: TGACGTGAG at 4341, TAACGTGAG at 3290 Positive strand, negative direction: ATCACGCCA at 3282
182. p53 response elements	(A/G)(A/G)(A/G)C(A/T)(A/T)G(C/T)(C/T)(C/T)	Y	Negative, negative direction: AGACAAGCTT at 4186
183. p63 DNA binding sites	(A/G)(A/G)(A/G)C(A/G)(A/T)G(C/T)(C/T)(C/T)(A/G)(A/G)(A/G)C(A/T)(C/T)G(C/T)(C/T)(C/T)	N	RRRC(A/G)(A/T)GYYYRRRC(A/T)(C/T)GYYY
184. P-box (Mena)	(A/T)AAAG	Y	Negative strand, negative direction: CTTTT at 4395, CTTTT at 4390, CTTTT at 4383, TAAAG at 3688, TAAAG at 2884 Positive strand, negative direction: AAAAG at 4391, AAAAG at 4386, AAAAG at 4379, AAAAG at 3440, AAAAG at 3344, CTTTT at 3019, TAAAG at 2857
185. P-box (Motojima)	TGAGTTCA	Y	-
186. P-box (Yu)	GTAA(T/C)	Y	Negative strand, negative direction: ATTAC at 3658, GTAAT at 3436, GTAAC at 3285, GTAAT at 2951 Positive strand, negative direction: GTAAT at 3973, ATTAC at 3469, GTAAT at 3064
187. Pdr1p/Pdr3ps	TCCGCGGA	N	Pdr1p/Pdr3p response elements (PDREs)
188. Peroxisome proliferator-activated receptor alpha	CGACCCC	Y	Negative strand, negative direction: CGACCCC at 3037
189. Peroxisome proliferator hormone response elements (PPREs)	AGGTCANAGGTCA	N	PPARs/RXRs heterodimers bind to PPRE
190. Pho4ps	CAC(A/G)T(T/G)	Y	Negative strand, negative direction: TTACAC at 4091, AACGTG at 3288, CACGTT at 2864 Positive strand, negative direction: CACATT at 4533
191. Pollen1 elements	AGAAA	Y	Negative strand, negative direction: TTTCT at 4505, TTTCT at 4392, TTTCT at 4387, TTTCT at 4380, TTTCT at 4083, TTTCT at 3924, TTTCT at 3665, TTTCT at 3378, TTTCT at 2892 Positive strand, negative direction: AGAAA at 4394, AGAAA at 4389, AGAAA at 4382, AGAAA at 4085, AGAAA at 4081, AGAAA at 3591, AGAAA at 3376, AGAAA at 3342
192. Pollen1 with TCCACCATA	AGAAANNNNTCCACCATA	N	adjacent co-dependent regulatory element TCCACCATA
193. Polycomb response elements	CGCCAT(A/T)TT	N	CGCCATTT
194. Polycomb response elements (PRE)	GCCAT	Y	Positive strand, negative direction: GCCAT at 3685, ATGGC at 3629, GCCAT at 3283, ATGGC at 3005, ATGGC at 2907
195. Pribnow boxes	TATAAT	Y	Negative strand, negative direction: TATAAT at 3468, TATAAT at 3454
196. Prolamin boxes	TG(A/T)AAAG	Y	Negative strand, negative direction: TGTAAAG at 2884
197. Pyrimidine boxes	CCTTTT	Y	Negative strand, negative direction: CCTTTT at 2968, CCTTTT at 2927 Positive strand, negative direction: AAAAGG at 3441, AAAAGG at 3345
198. Q elements See Retinoic acid response element	AGGTCA	Y	Positive strand, negative direction: AGGTCA at 4307
199. Quinone reductase response element (QRDRE) (Yao)	TCCCCT of TCCCCTTGCGTG	Y	-
200. Rap1 regulatory factors	ACCC(A/G)N(A/G)CA	N	"(ACCCRnRCA), less than half of the sites were detectably bound"^[3]
201. Rap1 reduced consensus	(A/G)(A/C)ACCC(A/G)N(A/G)C(A/C)(C/T)(A/C)	Y	Positive strand, positive direction: GAACCCACACCTC at 1807
202. Reb1 bound and exact occurrences	TTACCC(G/T)	Y	Negative strand, negative direction: TTACCCT at 3661
203. Extended Reb1	ATTACCCGAA	N	"extended motif VTTACCCGNH (IUPAC nomenclature) (Rhee and Pugh 2011)."^[3]
204. Retinoic acid response element	AG(A/G)TCA	Y	Negative strand, negative direction: TGATCT at 3463
205. Glucose transporter gene repressor (Rgt1)	CGG(A/G)(A/T)N(A/T)(A/T)	Y	Negative strand, negative direction: ATTTTCCG at 3442
206. Rlm1ps	CTATATATAG	N	CTA(T/A)₄TAG
207. classic RORE motif (RORE)	A(A/T)NTAGGTCA	Y	-
208. variant RORE motif	C(T/A)(G/A)GGNCA	Y	Negative strand, negative direction: CTGGGACA at 4369, CTGGGACA at 4208
209. Rox1ps	RRRTAACAAGAG	N	Heme-dependent repressor of hypoxic genes.^[28]
210. Rpn4ps	GGTGGCAAA	N	proteasome genes
211. R response elements (RRE)	CATCTG	Y	Negative strand, negative direction: CAGATG at 4212, CAGATG at 2988 Positive strand, negative direction: CAGATG at 3919, CAGATG at 3627, CAGATG at 3620
212. Seed-specific elements	CATGCATG	N	SRE consensus: CAGCAGATTGCG is none
213. Serum response elements (SRE) see CArG boxes	ACAGGATGT	Y	Negative strand, positive direction: ACAGGATGT at 3575
214. Servenius sequences	GGACCCT	Y	Negative strand, negative direction: GGACCCT at 4548, GGACCCT at 4496, GGACCCT at 4302
215. Shoot specific elements	GATAATGATG	N	SRE consensus: CAGCAGATTGCG is none
216. Sip4ps	CCGTCCGT	⌘F	CC(C/G)T(C/T)C(C/G)TCCG
217. Smp1ps	ACTACTA	⌘F	5-ACTACTA(T/A)4TAG
218. STAT5	TTCNNNGAA	Y	Positive strand, negative direction: TTCCCTGAA at 3782, TTCGTTGAA at 3506
219. Sterol response elements	TCGTATA	⌘F	perhaps plant specific
220. Stress-response elements (STREs)	CCCCT	Y	Negative strand, negative direction: CCCCT at 2924 Positive strand, negative direction: CCCCT at 3059
221. TACTAAC boxes	TACTAA(C/T)	Y	Positive strand, positive direction: TACTAAT at 4157, ATTAGTA at 4148
222. TATA boxes	TATA(A/T)A(A/T)(A/G)	Y	Negative strand, negative direction: TTTATATA at 2871 Positive strand, negative direction: TATATAAA at 2874
223. TATCCAC boxes	TATCCAC	N	GA responsive complex component
224. TCCACCATA elements	TCCACCATA	N	adjacent co-dependent regulatory element of POLLEN1
225. Tec1ps	GAATGT	⌘F	Ste12p cofactor
226. Tetradecanoylphorbol-13-acetate response elements (TREs)	TGA(G/C)TCA	N	cis-regulatory element of the human metallothionein IIa (hMTIIa) promoter and SV40
227. TGF-β control elements (TCEs)	GAGTGGGGCG	⌘F	in mouse and rat, GCGTGGGGGA in humans
228. TGF-β inhibitory elements (TIEs)	GAGTGGTGA	N	in the rat transin/stromelysin promoter
229. Thyroid hormone response elements (TREs)	AGGTCA	⌘F	See VDREs, X boxes
230. Unfolded protein response element (URE) (UPRE-1)	CANCNTG	Y	Positive strand, negative direction: CAGCCTG at 4348, CATGGTG at 4109, CAGCCTG at 4036, CATCCTG at 3905, CACCCTG at 3743, CAGCCTG at 3297, CAAGGTG at 3143, CAGCCTG at 3127
231. Unfolded protein response elements (UPREs)	TGACGTG(G/A)	⌘F	XBP1 binds to UPRE
232. Upstream stimulating factors (USFs)	GCC(A/T)NN(C/G/T)(A/G)	Y	Negative strand, negative direction: CGGTCCAC at 3953 Positive strand, negative direction: CAGATGGC at 3629
233. V boxes	(A/G)TT(A/T)(C/T)	Y	Negative strand, negative direction: ATAAT at 4538, AAAAT at 4512, GTTTC at 4504, GAAAC at 4462, GTTTT at 4376, GTTTT at 4310, ATTAT at 4223, GTTTT at 4216 Positive strand, negative direction: ATTTT at 4511, AAAAC at 4396, AAAAC at 4311, ATAAT at 4225, ATAAT at 4222, AAAAT at 4219
234. Vhr1ps	AATCA-N₈-TGA(C/T)T	⌘F	Response to low biotin [71] concentrations
235. Vitamin D response elements (VDREs)	(A/G)G(G/T)(G/T)CA	⌘F	AGGTCA not ⌘F
236. W boxes	(C/T)TGAC(C/T)	Y	Negative strand, negative direction: GGTCAA at 4416, GGTCAA at 4308, CTGACC at 3749
237. X boxes	GTTGGCATGGCAAC	N	X2 box is AGGTCCA not ⌘F
238. Xbp1ps	GcCTCGA(G/A)G(C/A)g(a/g)	⌘F	Transcriptional repressor
239. X core promoter elements	(A/G/T)(C/G)G(C/T)GG(A/G)A(C/G)(A/C)	Y	Negative strand, negative direction: TGGTGGGACC at 3744
240. Xenobiotic response elements (XREs)	GCGTG	Y	Positive strand, negative direction: CACGC at 3280, GCGTG at 3046
241. Xenobiotic response elements (XREs)	(T/G)NGCGTG(A/C)(G/C)A	⌘F	contains the core sequence GCGTG
242. Yap1p,2ps	TTACTAA	⌘F	Yap1p binding sites
243. Y boxes	(A/G)CTAACC(A/G)(A/G)(C/T)	N	inverted CAAT box
244. Zap1ps	ACCCTCA	⌘F	ACC(C/T)(C/T)(A/C/G/T)AAGGT
245. Z boxes	A(C/T)A(C/G)GT(A/G)T	Y	Positive strand, negative direction: ACACCTGT at 3970, ATACCTAT at 2996

Acknowledgements

The content on this page was first contributed by: Henry A. Hoff.

References

↑ MeSH (8 July 2008). "Response Elements". U.S. National Library of Medicine, 8600 Rockville Pike, Bethesda, MD 20894: National Institutes of Health, Health & Human Services. Retrieved 2 September 2020.
↑ ^2.0 ^2.1 ^2.2 Kenneth A. Watanabe; Arielle Homayouni; Lingkun Gu; Kuan‐Ying Huang; Tuan‐Hua David Ho; Qingxi J. Shen (18 June 2017). "Transcriptomic analysis of rice aleurone cells identified a novel abscisic acid response element". Plant, Cell & Environment. 40 (9): 2004–2016. doi:10.1111/pce.13006. Retrieved 5 October 2020.
↑ ^3.0 ^3.1 ^3.2 ^3.3 Matthew J. Rossi; William K.M. Lai; B. Franklin Pugh (21 March 2018). "Genome-wide determinants of sequence-specific DNA binding of general regulatory factors". Genome Research. 28: 497–508. doi:10.1101/gr.229518.117. PMID 29563167. Retrieved 31 August 2020.
↑ Z G E, Zhang YP, Zhou JH, Wang L (April 2014). "Mini review roles of the bZIP gene family in rice". Genetics and Molecular Research. 13 (2): 3025–36. doi:10.4238/2014.April.16.11. PMID 24782137. Vancouver style error: name (help)
↑ Takayuki Murata; Chieko Noda; Yohei Narita1; Takahiro Watanabe; Masahiro Yoshida; Keiji Ashio; Yoshitaka Sato; Fumi Goshima; Teru Kanda; Hironori Yoshiyama; Tatsuya Tsurumi; Hiroshi Kimura (27 January 2016). "Induction of Epstein-Barr Virus Oncoprotein Latent Membrane Protein 1 (LMP1) by Transcription Factors Activating Protein 2 (AP-2) and Early B Cell Factor (EBF)" (PDF). Journal of Virology. doi:10.1128/JVI.03227-15. Retrieved 4 October 2020.
↑ ^6.0 ^6.1 Yao EF; Denison MS (June 1992). "DNA sequence determinants for binding of transformed Ah receptor to a dioxin-responsive enhancer". Biochemistry. 31 (21): 5060–7. doi:10.1021/bi00136a019. PMID 1318077.
↑ ^7.0 ^7.1 ^7.2 ^7.3 Bhaskar Sharma; Joemar Taganna (12 June 2020). "Genome-wide analysis of the U-box E3 ubiquitin ligase enzyme gene family in tomato". Scientific Reports. 10 (9581). doi:10.1038/s41598-020-66553-1. PMID 32533036 Check |pmid= value (help). Retrieved 27 August 2020.
↑ ^8.0 ^8.1 Ryuto Maruyama; Makoto Shimizu; Juan Li, Jun Inoue; Ryuichiro Sato (24 March 2016). "Fibroblast growth factor 21 induction by activating transcription factor 4 is regulated through three amino acid response elements in its promoter region". Bioscience, Biotechnology, and Biochemistry. 80 (5): 929–934. doi:10.1080/09168451.2015.1135045. Retrieved 4 October 2020.
↑ Angelika Bröer; Gregory Gauthier-Coles; Farid Rahimi; Michelle van Geldermalsen; Dieter Dorsch􏰀; Ansgar Wegener; Jeff Holst; Stefan Bröer (March 15, 2019). "Ablation of the ASCT2 (SLC1A5) gene encoding a neutral amino acid transporter reveals transporter plasticity and redundancy in cancer cells" (PDF). Journal of Biological Chemistry. 294 (11): 4012–4026. doi:10.1074/jbc.RA118.006378. Retrieved 4 October 2020.
↑ Alisa A. Garaeva; Irina E. Kovaleva; Peter M. Chumakov; Alexandra G. Evstafieva (15 January 2016). "Mitochondrial dysfunction induces SESN2 gene expression through Activating Transcription Factor 4". Cell Cycle. 15 (1): 64–71. doi:10.1080/15384101.2015.1120929. PMID 26771712. Retrieved 5 September 2020.
↑ ^11.0 ^11.1 S Kouhpayeh; AR Einizadeh; Z Hejazi; M Boshtam; L Shariati; M Mirian; L Darzi; M Sojoudi; H Khanahmad; A Rezaei (1 July 2016). "Antiproliferative effect of a synthetic aptamer mimicking androgen response elements in the LNCaP cell line" (PDF). Cancer Gene Therapy. 23: 254–257. doi:10.1038/cgt.2016.26. Retrieved 3 October 2020.
↑ ^12.0 ^12.1 Stephen Wilson; Jianfei Qi; Fabian V. Filipp (14 September 2016). "Refinement of the androgen response element based on ChIP-Seq in androgen-insensitive and androgen-responsive prostate cancer cell lines". Scientific Reports. 6: 32611. doi:10.1038/srep32611. Retrieved 3 October 2020.
↑ Akihito Otsuki; Mikiko Suzuki; Fumiki Katsuoka; Kouhei Tsuchida; Hiromi Suda; Masanobu Morita; Ritsuko Shimizu; Masayuki Yamamoto (February 2016). "Unique cistrome defined as CsMBE is strictly required for Nrf2-sMaf heterodimer function in cytoprotection". Free Radical Biology and Medicine. 91: 45–57. doi:10.1016/j.freeradbiomed.2015.12.005. PMID 26677805. Retrieved 21 August 2020.
↑ Sarah E. Lacher; Daniel C. Levings; Samuel Freeman; Matthew Slattery (October 2018). "Identification of a functional antioxidant response element at the HIF1A locus". Redox Biology. 19: 401–411. doi:10.1016/j.redox.2018.08.014. Retrieved 6 October 2020.
↑ Xu Tao; Anne E. West; Wen G. Chen; Gabriel Corfas; Michael E. Greenberg (2002). "A calcium-responsive transcription factor, CaRF, that regulates neuronal activity-dependent expression of BDNF". Neuron. 33: 383–95. doi:10.1016/S0896-6273(01)00561-X. PMID 11832226. Retrieved 2 September 2020.
↑ Jianyin Long; Daniel L. Galvan; Koki Mise; Yashpal S. Kanwar; Li Li; Naravat Poungavrin; Paul A. Overbeek; Benny H. Chang; Farhad R. Danesh (28 May 2020). "Role for carbohydrate response element-binding protein (ChREBP) in high glucose-mediated repression of long noncoding RNA Tug1" (PDF). Journal of Biological Chemistry. 5 (28). doi:10.1074/jbc.RA120.013228. Retrieved 6 October 2020.
↑ ^17.0 ^17.1 PA Johnson; D Bunick; NB Hecht (1991). "Protein Binding Regions in the Mouse and Rat Protamine-2 Genes" (PDF). Biology of Reproduction. 44 (1): 127–134. doi:10.1095/biolreprod44.1.127. PMID 2015343. Retrieved 6 April 2019.
↑ ^18.0 ^18.1 Young Hun Song; Cheol Min Yoo; An Pio Hong; Seong Hee Kim; Hee Jeong Jeong; Su Young Shin; Hye Jin Kim; Dae-Jin Yun; Chae Oh Lim; Jeong Dong Bahk; Sang Yeol Lee; Ron T. Nagao; Joe L. Key; Jong Chan Hong (April 2008). "DNA-Binding Study Identifies C-Box and Hybrid C/G-Box or C/A-Box Motifs as High-Affinity Binding Sites for STF1 and LONG HYPOCOTYL5 Proteins" (PDF). Plant Physiology. 146 (4): 1862–1877. doi:10.1104/pp.107.113217. PMID 18287490. Retrieved 26 March 2019.
↑ Hideharu Hashimoto; Dongxue Wang; John R. Horton; Xing Zhang; Victor G. Corces; Xiaodong Cheng (1 June 2017). "Structural Basis for the Versatile and Methylation-Dependent Binding of CTCF to DNA". Molecular Cell. 66 (5): 711–720.e3. doi:10.1016/j.molcel.2017.05.004. PMID 28529057. Retrieved 28 August 2020.
↑ Ravi P. Misra; Azad Bonni; Cindy K. Miranti; Victor M. Rivera; Morgan Sheng; Michael E.Greenberg (14 October 1994). "L-type Voltage-sensitive Calcium Channel Activation Stimulates Gene Expression by a Serum Response Factor-dependent Pathway" (PDF). The Journal of Biological Chemistry. 269 (41): 25483–25493. PMID 7929249. Retrieved 7 December 2019.
↑ Yan-Hui Li; Gai-Gai Zhang (12 April 2016). "Towards understanding the lifespan extension by reduced insulin signaling: bioinformatics analysis of DAF-16/FOXO direct targets in Caenorhabditis elegans". Oncotarget. 7 (15): 19185–19192. doi:10.18632/oncotarget.8313. PMID 2702736. Retrieved 27 August 2020.
↑ ^22.0 ^22.1 Philipp Mracek; Cristina Santoriello; M. Laura Idda; Cristina Pagano; Zohar Ben-Moshe; Yoav Gothilf; Daniela Vallone; Nicholas S. Foulkes (December 6, 2012). "Regulation of per and cry Genes Reveals a Central Role for the D-Box Enhancer in Light-Dependent Gene Expression". PLoS ONE. 7 (12): e51278. doi:10.1371/journal.pone.0051278. Retrieved 10 February 2019.
↑ Joshua J. Smith, Eric S. Cole, Daniel P. Romero (15 July 2004). "Transcriptional control of RAD51 expression in the ciliate Tetrahymena thermophila". Nucleic Acids Research. 32 (14): 4313–4321. doi:10.1093/nar/gkh771. PMID 15304567. Retrieved 4 September 2020.
↑ Roberta A. Sumrada and Terrance G. Cooper (June 1987). "Ubiquitous upstream repression sequences control activation of the inducible arginase gene in yeast" (PDF). Proceedings of the National Academy of Sciences USA. 84: 3997–4001. doi:10.1073/pnas.84.12.3997. PMID 3295874. Retrieved 6 September 2020.
↑ Fumiko Hirose; Masamitsu Yamaguchi; Akio Matsukage (September 1999). "Targeted Expression of the DNA Binding Domain of DRE-Binding Factor, a Drosophila Transcription Factor, Attenuates DNA Replication of the Salivary Gland and Eye Imaginal Disc". Molecular and Cellular Biology. 19 (9): 6020–6028. doi:10.1128/MCB.19.9.6020. PMID 10454549. Retrieved 4 September 2020.
↑ Annkatrin Rose, Iris Meier and Udo Wienand (28 October 1999). "The tomato I-box binding factor LeMYBI is a member of a novel class of Myb-like proteins". The Plant Journal. 20 (6): 641–652. doi:10.1046/j.1365-313X.1999.00638.x. Retrieved 8 November 2018.
↑ Eiji Yoshihara (18 August 2020). "TXNIP/TBP-2: A Master Regulator for Glucose Homeostasis". Antioxidants. 9 (8): 765–84. doi:10.3390/antiox9080765. PMID 32824669 Check |pmid= value (help). Retrieved 5 September 2020.
↑ ^28.0 ^28.1 ^28.2 Hongting Tang, Yanling Wu, Jiliang Deng, Nanzhu Chen, Zhaohui Zheng, Yongjun Wei, Xiaozhou Luo, and Jay D. Keasling (6 August 2020). "Promoter Architecture and Promoter Engineering in Saccharomyces cerevisiae". Metabolites. 10 (8): 320–39. doi:10.3390/metabo10080320. PMID 32781665 Check |pmid= value (help). Retrieved 18 September 2020.
↑ ^29.0 ^29.1 ^29.2 Liu-Min Fan, Xiaoyan Feng, Yu Wang and Xing Wang Deng (2007). "Gibberellin Signal Transduction in Rice". Journal of Integrative Plant Biology. 49 (6): 731−741. doi:10.1111/j.1744-7909.2007.00511.x. Retrieved 16 October 2018.
↑ Nesrin Ozsarac, Melissa J. Straffon, Hazel E. Dalton, and Ian W. Dawes (March 1997). "Regulation of Gene Expression during Meiosis in Saccharomyces cerevisiae: SPR3 Is Controlled by both ABFI and a New Sporulation Control Element". Molecular and Cellular Biology. 17 (3): 1152–9. doi:10.1128/MCB.17.3.1152. PMC 231840. PMID 9032242.
↑ Qingliang Li, Rezaul M. Karim, Mo Cheng, Mousumi Das, Lihong Chen, Chen Zhang, Harshani R. Lawrence, Gary W. Daughdrill, Ernst Schonbrunn, Haitao Ji and Jiandong Chen (July 2020). "Inhibition of p53 DNA binding by a small molecule protects mice from radiation toxicity". Oncogene. 39 (29): 5187–5200. doi:10.1038/s41388-020-1344-y. PMID 32555331 Check |pmid= value (help). Retrieved 29 August 2020.
↑ Marilyn Kozak (October 1987). "An analysis of 5'-noncoding sequences from 699 vertebrate messenger RNAs". Nucleic Acids Research. 15 (20): 8125–8148. doi:10.1093/nar/15.20.8125. PMID 3313277.
↑ Takuya Matsumoto; Saemi Kitajima; Chisato Yamamoto; Mitsuru Aoyagi; Yoshiharu Mitoma; Hiroyuki Harada; Yuji Nagashima (9 August 2020). "Cloning and tissue distribution of the ATP-binding cassette subfamily G member 2 gene in the marine pufferfish Takifugu rubripes" (PDF). Fisheries Science. 86: 873–887. doi:10.1007/s12562-020-01451-z. Retrieved 27 September 2020.
↑ Robert G. K. Donald and Anthony R. Cashmore (1990). "Mutation of either G box or I box sequences profoundly affects expression from the Arabidopsis rbcS‐1A promoter". The EMBO Journal. 9 (6): 1717–1726. doi:10.1002/j.1460-2075.1990.tb08295.x. Retrieved 8 November 2018.
↑ Motoki Kyo, Tae Yamamoto, Hozumi Motohashi, Terue Kamiya, Toshihiro Kuroita, Toshiyuki Tanaka, James Douglas Engel, Bunsei Kawakami, Masayuki Yamamoto (13 February 2004). "Evaluation of MafG interaction with Maf recognition element arrays by surface plasmon resonance imaging technique". Genes to Cells. 9 (2). doi:10.1111/j.1356-9597.2004.00711.x. Retrieved 8 September 2020.
↑ Corine Bertolotto, Roser Buscà, Patricia Abbe, Karine Bille, Edith Aberdam, Jean-Paul Ortonne, and Robert Ballotti (February 1998). "Different cis-Acting Elements Are Involved in the Regulation of TRP1 and TRP2 Promoter Activities by Cyclic AMP: Pivotal Role of M Boxes (GTCATGTGCT) and of Microphthalmia". Molecular and Cellular Biology. 18 (2): 694–702. PMID 9447965. Retrieved 8 December 2018.
↑ Pierre‐Louis Blaiseau and Dominique Thomas (2 November 1998). "Multiple transcriptional activation complexes tether the yeast activator Met4 to DNA". The EMBO Journal. 17: 6327–6336. doi:10.1093/emboj/17.21.6327. |access-date= requires |url= (help)

External links

{{Phosphate biochemistry}}

[MeSHD020218-1] MeSH (8 July 2008). "Response Elements". U.S. National Library of Medicine, 8600 Rockville Pike, Bethesda, MD 20894: National Institutes of Health, Health & Human Services. Retrieved 2 September 2020.

[Watanabe-2] 2.0 ^2.1 ^2.2 Kenneth A. Watanabe; Arielle Homayouni; Lingkun Gu; Kuan‐Ying Huang; Tuan‐Hua David Ho; Qingxi J. Shen (18 June 2017). "Transcriptomic analysis of rice aleurone cells identified a novel abscisic acid response element". Plant, Cell & Environment. 40 (9): 2004–2016. doi:10.1111/pce.13006. Retrieved 5 October 2020.

[Rossi-3] 3.0 ^3.1 ^3.2 ^3.3 Matthew J. Rossi; William K.M. Lai; B. Franklin Pugh (21 March 2018). "Genome-wide determinants of sequence-specific DNA binding of general regulatory factors". Genome Research. 28: 497–508. doi:10.1101/gr.229518.117. PMID 29563167. Retrieved 31 August 2020.

[Zhang-4] Z G E, Zhang YP, Zhou JH, Wang L (April 2014). "Mini review roles of the bZIP gene family in rice". Genetics and Molecular Research. 13 (2): 3025–36. doi:10.4238/2014.April.16.11. PMID 24782137. Vancouver style error: name (help)

[Murata-5] Takayuki Murata; Chieko Noda; Yohei Narita1; Takahiro Watanabe; Masahiro Yoshida; Keiji Ashio; Yoshitaka Sato; Fumi Goshima; Teru Kanda; Hironori Yoshiyama; Tatsuya Tsurumi; Hiroshi Kimura (27 January 2016). "Induction of Epstein-Barr Virus Oncoprotein Latent Membrane Protein 1 (LMP1) by Transcription Factors Activating Protein 2 (AP-2) and Early B Cell Factor (EBF)" (PDF). Journal of Virology. doi:10.1128/JVI.03227-15. Retrieved 4 October 2020.

[Yao-6] 6.0 ^6.1 Yao EF; Denison MS (June 1992). "DNA sequence determinants for binding of transformed Ah receptor to a dioxin-responsive enhancer". Biochemistry. 31 (21): 5060–7. doi:10.1021/bi00136a019. PMID 1318077.

[Sharma-7] 7.0 ^7.1 ^7.2 ^7.3 Bhaskar Sharma; Joemar Taganna (12 June 2020). "Genome-wide analysis of the U-box E3 ubiquitin ligase enzyme gene family in tomato". Scientific Reports. 10 (9581). doi:10.1038/s41598-020-66553-1. PMID 32533036 Check |pmid= value (help). Retrieved 27 August 2020.

[Maruyama-8] 8.0 ^8.1 Ryuto Maruyama; Makoto Shimizu; Juan Li, Jun Inoue; Ryuichiro Sato (24 March 2016). "Fibroblast growth factor 21 induction by activating transcription factor 4 is regulated through three amino acid response elements in its promoter region". Bioscience, Biotechnology, and Biochemistry. 80 (5): 929–934. doi:10.1080/09168451.2015.1135045. Retrieved 4 October 2020.

[Broer-9] Angelika Bröer; Gregory Gauthier-Coles; Farid Rahimi; Michelle van Geldermalsen; Dieter Dorsch􏰀; Ansgar Wegener; Jeff Holst; Stefan Bröer (March 15, 2019). "Ablation of the ASCT2 (SLC1A5) gene encoding a neutral amino acid transporter reveals transporter plasticity and redundancy in cancer cells" (PDF). Journal of Biological Chemistry. 294 (11): 4012–4026. doi:10.1074/jbc.RA118.006378. Retrieved 4 October 2020.

[Garaeva-10] Alisa A. Garaeva; Irina E. Kovaleva; Peter M. Chumakov; Alexandra G. Evstafieva (15 January 2016). "Mitochondrial dysfunction induces SESN2 gene expression through Activating Transcription Factor 4". Cell Cycle. 15 (1): 64–71. doi:10.1080/15384101.2015.1120929. PMID 26771712. Retrieved 5 September 2020.

[Kouhpayeh-11] 11.0 ^11.1 S Kouhpayeh; AR Einizadeh; Z Hejazi; M Boshtam; L Shariati; M Mirian; L Darzi; M Sojoudi; H Khanahmad; A Rezaei (1 July 2016). "Antiproliferative effect of a synthetic aptamer mimicking androgen response elements in the LNCaP cell line" (PDF). Cancer Gene Therapy. 23: 254–257. doi:10.1038/cgt.2016.26. Retrieved 3 October 2020.

[Wilson-12] 12.0 ^12.1 Stephen Wilson; Jianfei Qi; Fabian V. Filipp (14 September 2016). "Refinement of the androgen response element based on ChIP-Seq in androgen-insensitive and androgen-responsive prostate cancer cell lines". Scientific Reports. 6: 32611. doi:10.1038/srep32611. Retrieved 3 October 2020.

[Otsuki-13] Akihito Otsuki; Mikiko Suzuki; Fumiki Katsuoka; Kouhei Tsuchida; Hiromi Suda; Masanobu Morita; Ritsuko Shimizu; Masayuki Yamamoto (February 2016). "Unique cistrome defined as CsMBE is strictly required for Nrf2-sMaf heterodimer function in cytoprotection". Free Radical Biology and Medicine. 91: 45–57. doi:10.1016/j.freeradbiomed.2015.12.005. PMID 26677805. Retrieved 21 August 2020.

[Lacher-14] Sarah E. Lacher; Daniel C. Levings; Samuel Freeman; Matthew Slattery (October 2018). "Identification of a functional antioxidant response element at the HIF1A locus". Redox Biology. 19: 401–411. doi:10.1016/j.redox.2018.08.014. Retrieved 6 October 2020.

[Tao-15] Xu Tao; Anne E. West; Wen G. Chen; Gabriel Corfas; Michael E. Greenberg (2002). "A calcium-responsive transcription factor, CaRF, that regulates neuronal activity-dependent expression of BDNF". Neuron. 33: 383–95. doi:10.1016/S0896-6273(01)00561-X. PMID 11832226. Retrieved 2 September 2020.

[Long-16] Jianyin Long; Daniel L. Galvan; Koki Mise; Yashpal S. Kanwar; Li Li; Naravat Poungavrin; Paul A. Overbeek; Benny H. Chang; Farhad R. Danesh (28 May 2020). "Role for carbohydrate response element-binding protein (ChREBP) in high glucose-mediated repression of long noncoding RNA Tug1" (PDF). Journal of Biological Chemistry. 5 (28). doi:10.1074/jbc.RA120.013228. Retrieved 6 October 2020.

[Johnson-17] 17.0 ^17.1 PA Johnson; D Bunick; NB Hecht (1991). "Protein Binding Regions in the Mouse and Rat Protamine-2 Genes" (PDF). Biology of Reproduction. 44 (1): 127–134. doi:10.1095/biolreprod44.1.127. PMID 2015343. Retrieved 6 April 2019.

[Song-18] 18.0 ^18.1 Young Hun Song; Cheol Min Yoo; An Pio Hong; Seong Hee Kim; Hee Jeong Jeong; Su Young Shin; Hye Jin Kim; Dae-Jin Yun; Chae Oh Lim; Jeong Dong Bahk; Sang Yeol Lee; Ron T. Nagao; Joe L. Key; Jong Chan Hong (April 2008). "DNA-Binding Study Identifies C-Box and Hybrid C/G-Box or C/A-Box Motifs as High-Affinity Binding Sites for STF1 and LONG HYPOCOTYL5 Proteins" (PDF). Plant Physiology. 146 (4): 1862–1877. doi:10.1104/pp.107.113217. PMID 18287490. Retrieved 26 March 2019.

[Hashimoto-19] Hideharu Hashimoto; Dongxue Wang; John R. Horton; Xing Zhang; Victor G. Corces; Xiaodong Cheng (1 June 2017). "Structural Basis for the Versatile and Methylation-Dependent Binding of CTCF to DNA". Molecular Cell. 66 (5): 711–720.e3. doi:10.1016/j.molcel.2017.05.004. PMID 28529057. Retrieved 28 August 2020.

[Misra-20] Ravi P. Misra; Azad Bonni; Cindy K. Miranti; Victor M. Rivera; Morgan Sheng; Michael E.Greenberg (14 October 1994). "L-type Voltage-sensitive Calcium Channel Activation Stimulates Gene Expression by a Serum Response Factor-dependent Pathway" (PDF). The Journal of Biological Chemistry. 269 (41): 25483–25493. PMID 7929249. Retrieved 7 December 2019.

[Li-21] Yan-Hui Li; Gai-Gai Zhang (12 April 2016). "Towards understanding the lifespan extension by reduced insulin signaling: bioinformatics analysis of DAF-16/FOXO direct targets in Caenorhabditis elegans". Oncotarget. 7 (15): 19185–19192. doi:10.18632/oncotarget.8313. PMID 2702736. Retrieved 27 August 2020.

[Mracek-22] 22.0 ^22.1 Philipp Mracek; Cristina Santoriello; M. Laura Idda; Cristina Pagano; Zohar Ben-Moshe; Yoav Gothilf; Daniela Vallone; Nicholas S. Foulkes (December 6, 2012). "Regulation of per and cry Genes Reveals a Central Role for the D-Box Enhancer in Light-Dependent Gene Expression". PLoS ONE. 7 (12): e51278. doi:10.1371/journal.pone.0051278. Retrieved 10 February 2019.

[Smith-23] Joshua J. Smith, Eric S. Cole, Daniel P. Romero (15 July 2004). "Transcriptional control of RAD51 expression in the ciliate Tetrahymena thermophila". Nucleic Acids Research. 32 (14): 4313–4321. doi:10.1093/nar/gkh771. PMID 15304567. Retrieved 4 September 2020.

[Sumrada-24] Roberta A. Sumrada and Terrance G. Cooper (June 1987). "Ubiquitous upstream repression sequences control activation of the inducible arginase gene in yeast" (PDF). Proceedings of the National Academy of Sciences USA. 84: 3997–4001. doi:10.1073/pnas.84.12.3997. PMID 3295874. Retrieved 6 September 2020.

[Hirose-25] Fumiko Hirose; Masamitsu Yamaguchi; Akio Matsukage (September 1999). "Targeted Expression of the DNA Binding Domain of DRE-Binding Factor, a Drosophila Transcription Factor, Attenuates DNA Replication of the Salivary Gland and Eye Imaginal Disc". Molecular and Cellular Biology. 19 (9): 6020–6028. doi:10.1128/MCB.19.9.6020. PMID 10454549. Retrieved 4 September 2020.

[Rose-26] Annkatrin Rose, Iris Meier and Udo Wienand (28 October 1999). "The tomato I-box binding factor LeMYBI is a member of a novel class of Myb-like proteins". The Plant Journal. 20 (6): 641–652. doi:10.1046/j.1365-313X.1999.00638.x. Retrieved 8 November 2018.

[Yoshihara-27] Eiji Yoshihara (18 August 2020). "TXNIP/TBP-2: A Master Regulator for Glucose Homeostasis". Antioxidants. 9 (8): 765–84. doi:10.3390/antiox9080765. PMID 32824669 Check |pmid= value (help). Retrieved 5 September 2020.

[Tang-28] 28.0 ^28.1 ^28.2 Hongting Tang, Yanling Wu, Jiliang Deng, Nanzhu Chen, Zhaohui Zheng, Yongjun Wei, Xiaozhou Luo, and Jay D. Keasling (6 August 2020). "Promoter Architecture and Promoter Engineering in Saccharomyces cerevisiae". Metabolites. 10 (8): 320–39. doi:10.3390/metabo10080320. PMID 32781665 Check |pmid= value (help). Retrieved 18 September 2020.

[Fan-29] 29.0 ^29.1 ^29.2 Liu-Min Fan, Xiaoyan Feng, Yu Wang and Xing Wang Deng (2007). "Gibberellin Signal Transduction in Rice". Journal of Integrative Plant Biology. 49 (6): 731−741. doi:10.1111/j.1744-7909.2007.00511.x. Retrieved 16 October 2018.

[Ozsarac-30] Nesrin Ozsarac, Melissa J. Straffon, Hazel E. Dalton, and Ian W. Dawes (March 1997). "Regulation of Gene Expression during Meiosis in Saccharomyces cerevisiae: SPR3 Is Controlled by both ABFI and a New Sporulation Control Element". Molecular and Cellular Biology. 17 (3): 1152–9. doi:10.1128/MCB.17.3.1152. PMC 231840. PMID 9032242.

[Li2020-31] Qingliang Li, Rezaul M. Karim, Mo Cheng, Mousumi Das, Lihong Chen, Chen Zhang, Harshani R. Lawrence, Gary W. Daughdrill, Ernst Schonbrunn, Haitao Ji and Jiandong Chen (July 2020). "Inhibition of p53 DNA binding by a small molecule protects mice from radiation toxicity". Oncogene. 39 (29): 5187–5200. doi:10.1038/s41388-020-1344-y. PMID 32555331 Check |pmid= value (help). Retrieved 29 August 2020.

[Kozak1987-32] Marilyn Kozak (October 1987). "An analysis of 5'-noncoding sequences from 699 vertebrate messenger RNAs". Nucleic Acids Research. 15 (20): 8125–8148. doi:10.1093/nar/15.20.8125. PMID 3313277.

[Matsumoto-33] Takuya Matsumoto; Saemi Kitajima; Chisato Yamamoto; Mitsuru Aoyagi; Yoshiharu Mitoma; Hiroyuki Harada; Yuji Nagashima (9 August 2020). "Cloning and tissue distribution of the ATP-binding cassette subfamily G member 2 gene in the marine pufferfish Takifugu rubripes" (PDF). Fisheries Science. 86: 873–887. doi:10.1007/s12562-020-01451-z. Retrieved 27 September 2020.

[Donald-34] Robert G. K. Donald and Anthony R. Cashmore (1990). "Mutation of either G box or I box sequences profoundly affects expression from the Arabidopsis rbcS‐1A promoter". The EMBO Journal. 9 (6): 1717–1726. doi:10.1002/j.1460-2075.1990.tb08295.x. Retrieved 8 November 2018.

[Kyo-35] Motoki Kyo, Tae Yamamoto, Hozumi Motohashi, Terue Kamiya, Toshihiro Kuroita, Toshiyuki Tanaka, James Douglas Engel, Bunsei Kawakami, Masayuki Yamamoto (13 February 2004). "Evaluation of MafG interaction with Maf recognition element arrays by surface plasmon resonance imaging technique". Genes to Cells. 9 (2). doi:10.1111/j.1356-9597.2004.00711.x. Retrieved 8 September 2020.

[Bertolotto-36] Corine Bertolotto, Roser Buscà, Patricia Abbe, Karine Bille, Edith Aberdam, Jean-Paul Ortonne, and Robert Ballotti (February 1998). "Different cis-Acting Elements Are Involved in the Regulation of TRP1 and TRP2 Promoter Activities by Cyclic AMP: Pivotal Role of M Boxes (GTCATGTGCT) and of Microphthalmia". Molecular and Cellular Biology. 18 (2): 694–702. PMID 9447965. Retrieved 8 December 2018.

[Blaiseau-37] Pierre‐Louis Blaiseau and Dominique Thomas (2 November 1998). "Multiple transcriptional activation complexes tether the yeast activator Met4 to DNA". The EMBO Journal. 17: 6327–6336. doi:10.1093/emboj/17.21.6327. |access-date= requires |url= (help)

[1]

[2]

[3]

[4]

[5]

[6]

[7]

[8]

[9]

[10]

[11]

[12]

[13]

[14]

[15]

[16]

[17]

[18]

[19]

[20]

[21]

[22]

[23]

[24]

[25]

[26]

[27]

[28]

[29]

[30]

[31]

[32]

[33]

[34]

[35]

[36]

[37]

v t e Gene project
Articles	Complex locus A1BG and ZNF497 Grainyhead-like Genes in Regulating Development and Genetic Defects Lysenin Lysine: biosynthesis, catabolism and roles RIG-I like receptors ShK toxin: history, structure and therapeutic applications for autoimmune diseases
Categories	Biochemistry Biology Genetics Medicine
Laboratories	AGC box gene transcription laboratory ATA box gene transcription laboratory C and D boxes gene transcription laboratory CArG box gene transcription laboratory CGCG box gene transcription laboratory CRE box gene transcription laboratory E2 box gene transcription laboratory Enhancer box gene transcription laboratory Factor II B recognition element gene transcription laboratory GA responsive complex gene transcription laboratory GC box gene transcription laboratory H box gene transcription laboratory HNF6 gene transcription laboratory HY box gene transcription laboratory Initiator element gene transcription laboratory Metal responsive element gene transcription laboratory STAT5 gene transcription laboratory TATA box gene transcription laboratory
Lessons	A1BG gene transcription programming Amino Acids Enzymes Enzyme catalysis Enzyme structure and function Eukaryotic transcription Gene regulation in prokaryotes
Lists	Biomolecules
Modules	Module:Infobox gene Module:InfoboxImage
Original research	Gene project
Projects	Biochemistry Gene project History of biology Molecular Biology Molecular evolution Topobiology
Proposals	Gene expressions/Cost sharing and research products Gene expressions in human exploration beyond low earth orbits Gene expressions/Project narrative
Resources	5' cap Acid-base homeostasis Actins Adenines Allergies Alpha-1-B glycoprotein Ammonoids Original research/Amino acids Amphiphiles Anabolism Animal physiology Anomeric carbons Autocatalytic reactions Autonomously replicating sequences Base pairs Biology Biodegradation Biosynthesis Biosynthesis of a human protein Biosynthesis of amino acids Blood Bodily fluids Botany Brain box Calcium signaling Capping enzymes Carbohydrates Carcinoembryonic antigen gene family Catabolism Catalysis Cells Cell signaling Centrosomes Chromatins Chromoboxes Coactivators Corepressors Cofactors Consensus sequences Cytogenetics Cytokinesis Cytosines Deoxyribonucleic acids Digestion Disaccharides Dispersed promoters Dominant group metagenomes Downregulations Endochondral ossification Enzyme inhibitors Enzymology Epigenetics Epigenomes Esters Esterification Eukaryotes Eukaryotic initiation factors Evolution Exaptation Excision repair cross-complementing Factors Fatty acids Ferredoxin Foldings Foods Forkhead boxes Functional groups Genome surveillance complexes Genealogy Genes Genetics Gene transcriptions Genomes Genomics Glycoproteins Glycosides Glycosidic bond Guanines Hair color gene expressions Helicases Heredity History of agriculture Greek and Roman histories of biology Homeostasis Human amino acid synthesis Human DNAs Human genes Human RNA Human teeth Human temperatures Immunoglobulin domain cl11960 Immunoglobulin domain genes Immunoglobulin like domain cd05751 Immunoglobulin like domain pfam13895 Immunoglobulin like domain smart00410 Immunoglobulin receptor superfamily genes Immunoglobulin supergene family Inhibitory peptides Insulators Intranuclear localizations Introduction to Cell Biology Introduction to polymer chemistry Lamarckism Leucine zipper Localization Major histocompatibility complex class I gene family Major histocompatibility complex class II gene family Major histocompatibility complex class III gene family Mammalogy Mathematical molecular biology Mediator complexes Medicine Melanocytes Membranes Metagenomes Molecular biology Molecular genetics Nitrogen metabolism Nucleotide Synthesis Origin of life Orthomolecular medicine Osteoarthritis Paleanthropology Paleontology Phosphate biochemistry Phosphate budgets Phosphate reactions Post translational modifications Principles of biosynthesis Protein isoform Proteins Proteomics Regulations Ribonucleotides Ribosomes RNA polymerases RNA polymerase II holoenzymes RNA polymerase II holoenzyme complexes RNA translations Salinity Stroke management Teeth TFIIA Transports Vascular endothelial growth factor A What is a human? Upregulations Upstream and downstream ZSCAN22 Zoology
Transcription resources	A1BG gene transcription core promoters A1BG gene transcriptions A1BG regulatory elements and regions A1BG response element gene transcriptions A1BG response element negative results A1BG response element positive results ABA-response element gene transcriptions Abf1 regulatory factor gene transcriptions A box gene transcriptions Abscisic acid-responsive elements ACGT-containing element gene transcriptions Activating protein gene transcriptions Activating transcription factor gene transcriptions Adenylate–uridylate rich element gene transcriptions Adr1p gene transcriptions Aft1p gene transcriptions AGC box gene transcriptions AGCE gene transcriptions Alpha-amylase conserved element gene transcriptions Amino acid response element gene transcriptions AARE-like Androgen response element gene transcriptions Angiotensinogen core promoter element gene transcriptions Antioxidant-electrophile responsive element gene transcriptions AP-2 (Roesler) elements ATA box gene transcriptions Auxin response factor gene transcriptions B box gene transcriptions Bioinformatics tool gene transcriptions Box gene transcriptions B recognition element upstream Bridge gene transcriptions CAAT box gene transcriptions CACA elements CadC binding domain gene transcriptions Calcineurin-responsive transcription factor gene transcriptions Calcium-response element gene transcriptions cAMP response element gene transcriptions C and D boxes gene transcriptions Carbohydrate response element gene transcriptions Carbon source-responsive element gene transcriptions Carcinoembryonic antigen gene family CARE gene transcriptions CArG box gene transcriptions CAT box gene transcriptions CAT-box-like elements Cat8p gene transcriptions Cbf1 regulatory factor gene transcriptions C box gene transcriptions CCCTC-binding factor gene transcriptions C-EBP box gene transcriptions Cell-cycle box gene transcriptions Cell cycle regulation gene transcriptions CENP-B box gene transcriptions CGCG box gene transcriptions Circadian control element gene transcriptions "Class C" (Leal) samplings Cold-responsive element gene transcriptions Complement copy gene transcriptions Complement-inverse copy gene transcriptions Consensus sequence gene transcriptions Constitutive decay elements Copper response element gene transcriptions Core promoter gene transcriptions Coupling element gene transcriptions CRE box gene transcriptions Cytokinin response regulator gene transcriptions Cytoplasmic polyadenylation element gene transcriptions DAF-16-associated element gene transcriptions DAF-16 binding element gene transcriptions D box gene transcriptions Defense and stress-responsive element gene transcriptions Degenerate nucleotide gene transcriptions Dispersed promoter gene transcriptions Distal promoter gene transcriptions DNA melting gene transcriptions DNA damage response element gene transcriptions DNA replication-related element gene transcriptions Downstream core element gene transcriptions Downstream promoter element gene transcriptions Downstream TFIIB recognition element gene transcriptions DREB box gene transcriptions E2 box gene transcriptions EIF4E basal element gene transcriptions EIN3 binding site gene transcriptions Enhancer activity copy gene transcriptions E box gene transcriptions Element gene transcriptions Endoplasmic reticulum stress response element gene transcriptions Endosperm expression gene transcriptions Enhancer box gene transcriptions Estrogen response element gene transcriptions Ethylene responsive element gene transcriptions Families of TATA box genes F box gene transcriptions Focused promoter gene transcriptions Forkhead box gene transcriptions Fur box gene transcriptions GAAC element gene transcriptions Gal4p gene transcriptions Γ-interferon activated sequence gene transcriptions GARE gene transcriptions GA responsive complex gene transcriptions GATA gene transcriptions G box gene transcriptions GC box gene transcriptions GCC box gene transcriptions Gcn4p gene transcriptions Gcr1p gene transcriptions Gene expressions General factor II D gene transcriptions General regulatory factors General transcription factor II A gene transcriptions General transcription factor II B gene transcriptions General transcription factor II D gene transcriptions General transcription factor II F gene transcriptions General transcription factor II H gene transcriptions General transcription factor gene transcriptions Gene transcriptions GGC triplet gene transcriptions Gibberellin responsive element gene transcriptions GLM box gene transcriptions Glucocorticoid response element gene transcriptions Grainy head gene transcriptions Grainy head transcription factor gene transcriptions Growth hormone response element gene transcriptions GT boxes Hac1p gene transcriptions Hair color gene expressions H and ACA box gene transcriptions H box gene transcriptions Heat-responsive element gene transcriptions Heat shock elements Hex sequence gene transcriptions HMG box gene transcriptions HNF gene transcriptions Homeobox gene transcriptions Hsf1p gene transcriptions HY box gene transcriptions Hybrid C, A boxes Hybrid C, G boxes Hybrid C, T boxes Hypoxia-inducible factor gene transcriptions Hypoxia response elements I box gene transcriptions Immunoglobulin like domain containing family Initiator element gene transcriptions Initiator-like element gene transcriptions Inositol/choline-responsive elements Interaction gene transcriptions Interferon regulatory factors Inverse copy gene transcriptions Jasmonic acid-responsive element gene transcriptions K-boxes Kozak sequence gene transcriptions Kruppel-associated box gene transcriptions Krüppel-like factor gene transcriptions L box gene transcriptions Leu3 gene transcriptions M35 box gene transcriptions MADS box gene transcriptions Maf recognition element gene transcriptions M box gene transcriptions M-CAT boxes Mcm1 regulatory factor gene transcriptions Met3 gene transcriptions Met31p box gene transcriptions Metal responsive element gene transcriptions Middle sporulation element gene transcriptions Mig1p gene transcriptions Model samplings Motif ten element gene transcriptions Msn2,4p gene transcriptions Musashi binding element gene transcriptions MYB recognition element gene transcriptions Myelocytomatosis transcription factor gene transcriptions Myocyte enhancer factor gene transcriptions N-boxes Nanos/Pumilio response element Ndt80p gene transcriptions Nuclear factor 1 Nuclear factor 𝜿B Nuclear factor gene transcriptions Nuclear factor of activated T cell gene transcriptions (NFAT) Nuclear factor Y gene transcriptions Nutrient-sensing response element gene transcriptions Oaf1p gene transcriptions ORE1 binding site gene transcriptions p53 response element gene transcriptions P63 DNA-binding site gene transcriptions P box gene transcriptions Pdr1,3p gene transcriptions Peroxisome proliferator hormone response element gene transcriptions Phosphate starvation-response transcription factor gene transcriptions Pollen1 element gene transcriptions Polycomb response element gene transcriptions Preinitiation complex Preinitiation complex gene transcriptions Pribnow box gene transcriptions Prolamin box gene transcriptions Promoter gene transcriptions Proximal promoter gene transcriptions Promoter occurrence gene transcriptions Pyrimidine box gene transcriptions Q element gene transcriptions Rap1 regulatory factor gene transcriptions Reb1 general regulatory factor gene transcriptions Retinoblastoma control element gene transcriptions Retinoic acid response element gene transcriptions Rgt1p gene transcriptions Rlm1p gene transcriptions RNA polymerase II gene transcriptions RNA polymerase II holoenzyme complex Root specific element gene transcriptions ROR-response element gene transcriptions Rox1p gene transcriptions Rpn4p gene transcriptions R response element gene transcriptions SARE gene transcriptions Seed-specific element gene transcriptions Serum response element gene transcriptions Servenius sequence gene transcriptions Shoot specific element gene transcriptions Shue boxes Sip4p gene transcriptions Smp1p gene transcriptions Sp1 (Berberich) elements Sp1 gene transcriptions Spaceflight gene expressions Specificity protein gene transcriptions STAT gene transcriptions Ste12p gene transcriptions Sterol response element gene transcriptions Sucrose box gene transcriptions Synaptic Activity-Responsive Elements TACTAAC box gene transcriptions TAGteam gene transcriptions Tapetum box gene transcriptions TATA binding protein associated factor gene transcriptions TATA binding protein gene transcriptions TATA box actin/cytoskeleton/contractile family TATA box albumin family TATA box aldolase family TATA box alkaline phosphatase family TATA box annexin family TATA box cytochrome superfamily TATA box gene transcriptions TATA box heat shock family TATA box histone family TATA box human genes TATA box keratin family TATA box lipase family TATA box peptidase family TATA box platelet-derived growth factor family TATA box selenium-binding family TATA box serine protease family TATA box serpin superfamily TATA box transforming growth factor superfamily TATA box trefoil family TATA box tumor necrosis factor superfamily TATA box zinc metalloenzyme family TAT box gene transcriptions TATC box gene transcriptions Tbf1 regulatory factor gene transcriptions T box gene transcriptions TCCACCATA element gene transcriptions TC element gene transcriptions TCT gene transcriptions TEA consensus sequence gene transcriptions Tec1p gene transcriptions Telomeric repeat DNA-binding factor gene transcriptions Tetradecanoylphorbol-13-acetate response element gene transcriptions TGF-β control elements (TCEs) TGF-β inhibitory elements (TIEs) Thyroid hormone response element gene transcriptions Transcriptional regulation Transcription bubble gene transcriptions Transcription factor gene transcriptions Transcription factor 3 gene transcriptions Transcription factory gene transcriptions Transcription start site gene transcriptions Translational control sequence gene transcriptions Tryptophan residue U box gene transcriptions Unfolded protein response element gene transcriptions Upstream repressor site 1 Upstream response element gene transcriptions Upstream stimulatory factor gene transcriptions UTR promoter gene transcriptions V and P box gene transcriptions V box gene transcriptions Vhr1p gene transcriptions Vitamin D response element gene transcriptions W box gene transcriptions X box gene transcriptions Xbp1p gene transcriptions X core promoter element gene transcriptions Xenobiotic response element gene transcriptions Xenobiotic responsive element gene transcriptions Yap1p,2p gene transcriptions Y box gene transcriptions YY1 gene transcriptions Zap1p gene transcriptions Z box gene transcriptions Zinc responsive element gene transcriptions

A1BG response element gene transcriptions: Difference between revisions

Revision as of 00:28, 25 February 2021

Contents

Hypotheses

Response element testing

Acknowledgements

See also

References

External links

Navigation menu

@@ Line 27: / Line 27: @@
 ! Authors !! !! !!
 |-
-| [[ABA-response element gene transcriptions|ABA responsive elements]]
+|1. [[ABA-response element gene transcriptions|ABA responsive elements]]
 (ABREs)
 || ACGTG(G/T)C || Y || -
 |-
-| [[ABA-response element gene transcriptions|novel ABA-response elements]]
+|2. [[ABA-response element gene transcriptions|novel ABA-response elements]]
 (ABREN, novel ABRE)
@@ Line 55: / Line 55: @@
 |accessdate=5 October 2020 }}</ref>
 |-
-| [[ABA-response element gene transcriptions|ABA-response element-like]]
+|3. [[ABA-response element gene transcriptions|ABA-response element-like]]
 (ABRE-like)
 || ACGTGTCC || N || third highest scoring motif<ref name=Watanabe/>
 |-
-| [[Abf1 regulatory factor gene transcriptions|Activated B-cell Factor-1s]]
+|4. [[Abf1 regulatory factor gene transcriptions|Activated B-cell Factor-1s]]
 (ABFs)
 || CGTNNNNN(A/G)(C/T)GA(C/T) || Y || -
 |-
-| [[Abf1 regulatory factor gene transcriptions|Abf1 regulatory factors]] || CGTCCTCTACGAT || N || CGTNNNNNACGAT<ref name=Rossi>{{ cite journal
+|5. [[Abf1 regulatory factor gene transcriptions|Abf1 regulatory factors]] || CGTCCTCTACGAT || N || CGTNNNNNACGAT<ref name=Rossi>{{ cite journal
 |author=Matthew J. Rossi
 |author2=William K.M. Lai
@@ Line 82: / Line 82: @@
 |accessdate=31 August 2020 }}</ref>
 |-
-| [[A box gene transcriptions|A boxes]] || TACGTA || Y || -
+|6. [[A box gene transcriptions|A boxes]] || TACGTA || Y || -
 |-
-| [[A box gene transcriptions|boxes A]] || TGACTCT || Y || -
+|7. [[A box gene transcriptions|boxes A]] || TGACTCT || Y || -
 |-
-| [[Phosphate starvation-response transcription factor gene transcriptions|Abscisic acid-responsive elements (Pho4s)]], [[G box gene transcriptions|G boxes]] || CACGTG<ref name=Zhang>{{ cite journal
+|9. [[Phosphate starvation-response transcription factor gene transcriptions|Abscisic acid-responsive elements (Pho4s)]], [[G box gene transcriptions|G boxes]] || CACGTG<ref name=Zhang>{{ cite journal
 | vauthors = Z G E, Zhang YP, Zhou JH, Wang L
 | title = Mini review roles of the bZIP gene family in rice
@@ Line 97: / Line 97: @@
 | doi = 10.4238/2014.April.16.11 }}</ref> || Y || -
 |-
-| [[ACGT-containing element gene transcriptions|ACGT-containing elements]] || ACGT || Y || -
+|10. [[ACGT-containing element gene transcriptions|ACGT-containing elements]] || ACGT || Y || -
 |-
-| [[Activating protein gene transcriptions|Activating protein 2]]
+|11. [[Activating protein gene transcriptions|Activating protein 2]]
 (AP2)
@@ Line 106: / Line 106: @@
 || GCCTGGCC || Y || -
 |-
-| [[Activating protein gene transcriptions|Activating protein 2]]
+|12. [[Activating protein gene transcriptions|Activating protein 2]]
 (Cohen)
 || TCCCCCGCCC || Y || -
 |-
-| [[Activating protein gene transcriptions|Activating protein 2]]
+|13. [[Activating protein gene transcriptions|Activating protein 2]]
 (Murata)
 || (C/G)CCN(3,4)GG(C/G) || Y || -
 |-
-| [[Activating protein gene transcriptions|Activating proteins]]
+|14. [[Activating protein gene transcriptions|Activating proteins]]
 (Murata)
@@ Line 145: / Line 145: @@
 |accessdate=4 October 2020 }}</ref>
 |-
-| [[Activating protein gene transcriptions|Activating protein 2]]
+|15. [[Activating protein gene transcriptions|Activating protein 2]]
 (Yao)
 || TCTTCCC || Y || -
 |-
-| [[Activating protein gene transcriptions|Activating protein 2]]
+|16. [[Activating protein gene transcriptions|Activating protein 2]]
 (Yao)
 || CTCCCA || Y || -
 |-
-| [[Activating protein gene transcriptions|Activating proteins]]
+|17. [[Activating protein gene transcriptions|Activating proteins]]
 (AP-2)
@@ Line 162: / Line 162: @@
 || GGCCAA || N || Activating protein 2 (AP-2)<ref name=Yao/>
 |-
-| [[Xenobiotic response element gene transcriptions|AhR-responsive elements]]
+|18. [[Xenobiotic response element gene transcriptions|AhR-responsive elements]]
 (AHRE)
@@ Line 169: / Line 169: @@
 || (G/T)NGCGTG(A/C)(C/G)A || N || in the promoter region of AhR responsive genes
 |-
-| [[Activating transcription factor gene transcriptions|Activating transcription factors]]
+|19. [[Activating transcription factor gene transcriptions|Activating transcription factors]]
 (Burton)
 || (A/C/G)TT(A/G/T)C(A/G)TCA || Y || -
 |-
-| [[Activating transcription factor gene transcriptions|Activating transcription factors]]
+|20. [[Activating transcription factor gene transcriptions|Activating transcription factors]]
 (Kilberg)
 || (A/G/T)TT(A/G/T)CATCA || Y || -
 |-
-| [[Adr1p gene transcriptions|Adr1ps]] || TTGG(A/G)G || Y || -
+|21. [[Adr1p gene transcriptions|Adr1ps]] || TTGG(A/G)G || Y || -
 |-
-| [[Aft1p gene transcriptions|Aft1s]] || (C/T)(A/G)CACCC(A/G) || Y || -
+|22. [[Aft1p gene transcriptions|Aft1s]] || (C/T)(A/G)CACCC(A/G) || Y || -
 |-
-| [[AGC box gene transcriptions|AGC boxes]] || AGCCGCC || Y || -
+|23. [[AGC box gene transcriptions|AGC boxes]] || AGCCGCC || Y || -
 |-
-| [[Xenobiotic responsive element gene transcriptions|AhR responsive element]]
+|24. [[Xenobiotic responsive element gene transcriptions|AhR responsive element]]
 (AHRE-II)
 || CATGN<sub>6</sub>C(A/T)TG || Y || -
 |-
-| [[Alpha-amylase conserved element gene transcriptions|Alpha-amylase conserved elements]] || TATCCA || N || TATCCATCCATCC<ref name=Sharma>{{ cite journal
+|25. [[Alpha-amylase conserved element gene transcriptions|Alpha-amylase conserved elements]] || TATCCA || N || TATCCATCCATCC<ref name=Sharma>{{ cite journal
 |author=Bhaskar Sharma
 |author2=Joemar Taganna
@@ Line 206: / Line 206: @@
 |accessdate=27 August 2020 }}</ref>
 |-
-| [[Amino acid response element gene transcriptions|Amino acid response elements]]
+|26. [[Amino acid response element gene transcriptions|Amino acid response elements]]
 (AARE)
@@ Line 213: / Line 213: @@
 || ATTGCATCA || N || AARE1 (ATTGCATCA)<ref name=Maruyama/>
 |-
-| [[Amino acid response element gene transcriptions|Amino acid response elements]]
+|27. [[Amino acid response element gene transcriptions|Amino acid response elements]]
 (AARE)
@@ Line 256: / Line 256: @@
 |accessdate=5 September 2020 }}</ref>
 |-
-| [[Amino acid response element gene transcriptions|Amino acid response element-like]]
+|28. [[Amino acid response element gene transcriptions|Amino acid response element-like]]
 (AARE-like)
@@ Line 277: / Line 277: @@
 |accessdate=4 October 2020 }}</ref>
 |-
-| [[Androgen response element gene transcriptions|Androgen response elements]]
+|29. [[Androgen response element gene transcriptions|Androgen response elements]]
 (AREs)
@@ Line 306: / Line 306: @@
 |accessdate=3 October 2020 }}</ref>
 |-
-| [[Androgen response element gene transcriptions|Androgen response elements]]
+|30. [[Androgen response element gene transcriptions|Androgen response elements]]
 (Kouhpayeh)
@@ Line 313: / Line 313: @@
 Positive strand: GGTACA at 3901, GGTACA at 3336, GGTACA at 2474
 |-
-| [[Androgen response element gene transcriptions|Androgen response elements]]
+|31. [[Androgen response element gene transcriptions|Androgen response elements]]
 (Wilson)
@@ Line 335: / Line 335: @@
 Positive strand: AGAACA at 3668, AGAACA at 287, TGTTCT at 45
 |-
-| [[Androgen response element gene transcriptions|Androgen response elements]]
+|32. [[Androgen response element gene transcriptions|Androgen response elements]]
 (AREs)
@@ Line 342: / Line 342: @@
 || TGATTCGTGAG || N || AGAACANNNTGTTCT<ref name=Wilson/>
 |-
-| [[Antioxidant-electrophile responsive element gene transcriptions|Antioxidant-electrophile responsive elements]]
+|33. [[Antioxidant-electrophile responsive element gene transcriptions|Antioxidant-electrophile responsive elements]]
 (Lacher)
 || GC(A/C/T)(A/G/T)(A/G/T)(C/G/T)T(A/C)A || Y || -
 |-
-| [[Antioxidant-electrophile responsive element gene transcriptions|Antioxidant-electrophile responsive elements]]
+|34. [[Antioxidant-electrophile responsive element gene transcriptions|Antioxidant-electrophile responsive elements]]
 (Otsuki)
@@ Line 388: / Line 388: @@
 |accessdate=6 October 2020 }}</ref>, an antioxidant response element (ARE)
 |-
-| [[ATA box gene transcriptions|ATA boxes]] || AATAAA || Y || -
+|35. [[ATA box gene transcriptions|ATA boxes]] || AATAAA || Y || -
 |-
-| [[Auxin response factor gene transcriptions|Auxin response factors]]
+|36. [[Auxin response factor gene transcriptions|Auxin response factors]]
 (Ulmasov)
 || TGTCTC || Y || -
 |-
-| [[Auxin response factor gene transcriptions|Auxin response factors]]
+|37. [[Auxin response factor gene transcriptions|Auxin response factors]]
 (Boer)
 || TGTCGG || Y || -
 |-
-| [[B box gene transcriptions|B-boxes]]
+|38. [[B box gene transcriptions|B-boxes]]
 (Johnson)
 || TGGGCA || Y || -
 |-
-| [[B box gene transcriptions|boxes B]]
+|39. [[B box gene transcriptions|boxes B]]
 (Sanchez)
 || TGTCTCA || Y || -
 |-
-| [[Factor II B recognition element gene transcriptions|B recognition elements]]
+|40. [[Factor II B recognition element gene transcriptions|B recognition elements]]
 (BRE<sup>u</sup>)
 || (G/C)(G/C)(G/A)CGCC || Y || -
 |-
-| [[CAAT box gene transcriptions|CAAT boxes]] || (C/T)(A/G)(A/G)CCAATC(A/G) || N || consensus sequence for the CCAAT-enhancer-binding site (C/EBP) is TAGCATT
+|41. [[CAAT box gene transcriptions|CAAT boxes]] || (C/T)(A/G)(A/G)CCAATC(A/G) || N || consensus sequence for the CCAAT-enhancer-binding site (C/EBP) is TAGCATT
 |-
-| [[CadC binding domain gene transcriptions|CadC binding domains]] || TTANNNNT || Y || -
+|42. [[CadC binding domain gene transcriptions|CadC binding domains]] || TTANNNNT || Y || -
 |-
-| [[Calcineurin-responsive transcription factor gene transcriptions|Calcineurin-responsive transcription factors]] || TG(A/C)GCCNC || Y || -
+|43. [[Calcineurin-responsive transcription factor gene transcriptions|Calcineurin-responsive transcription factors]] || TG(A/C)GCCNC || Y || -
 |-
-| [[Calcium-response element gene transcriptions|Calcium-response elements]] || CTATTTCGAG || N || CaRE1 CTATTTCGAG<ref name=Tao>{{ cite journal
+|44. [[Calcium-response element gene transcriptions|Calcium-response elements]] || CTATTTCGAG || N || CaRE1 CTATTTCGAG<ref name=Tao>{{ cite journal
 |author=Xu Tao
 |author2=Anne E. West
@@ Line 440: / Line 440: @@
 |accessdate=2 September 2020 }}</ref>
 |-
-| [[Carbohydrate response element gene transcriptions|Carbohydrate response elements]]
+|45. [[Carbohydrate response element gene transcriptions|Carbohydrate response elements]]
 (ChREs)
@@ Line 466: / Line 466: @@
 |accessdate=6 October 2020 }}</ref>
 |-
-| [[Carbohydrate response element gene transcriptions|Carbohydrate response elements]] || ChoRE1 ACCGG, ChoRE2 CCCAT || Y
+|46. [[Carbohydrate response element gene transcriptions|Carbohydrate response elements]] || ChoRE1 ACCGG, ChoRE2 CCCAT || Y
 || -
 |-
-| [[CARE gene transcriptions|CAACTC regulatory elements]]
+|47. [[CARE gene transcriptions|CAACTC regulatory elements]]
 (CAREs)
 || CAACTC || Y || -
 |-
-| [[CArG box gene transcriptions|CArG boxes]] || CCAAAAAT(G/A)G || Y || -
+|48. [[CArG box gene transcriptions|CArG boxes]] || CCAAAAAT(G/A)G || Y || -
 |-
-| [[Cat8p gene transcriptions|Cat8ps]] || CGG(A/C/G/T)(C/G/T)(A/C/G/T)(A/C/G)(A/C)(A/C/T)GGA || Y || -
+|49. [[Cat8p gene transcriptions|Cat8ps]] || CGG(A/C/G/T)(C/G/T)(A/C/G/T)(A/C/G)(A/C)(A/C/T)GGA || Y || -
 |-
-| [[CAT box gene transcriptions|CAT boxes]] || CATTCCT || Y || -
+|50. [[CAT box gene transcriptions|CAT boxes]] || CATTCCT || Y || -
 |-
-| [[Cbf1 regulatory factor gene transcriptions|Cbf1 regulatory factors]] || TCACGTGA || N || strongly bound Cbf1 motifs enriched at both ends with a "T" on the 5′ and "A" on the 3′ end
+|51. [[Cbf1 regulatory factor gene transcriptions|Cbf1 regulatory factors]] || TCACGTGA || N || strongly bound Cbf1 motifs enriched at both ends with a "T" on the 5′ and "A" on the 3′ end
 |-
-| [[C box gene transcriptions|C-boxes]]
+|52. [[C box gene transcriptions|C-boxes]]
 (Johnson)
@@ Line 502: / Line 502: @@
 |accessdate=6 April 2019 }}</ref>
 |-
-| [[C box gene transcriptions|C boxes]]
+|53. [[C box gene transcriptions|C boxes]]
 (Samarsky)
 || AGTAGT || Y || -
 |-
-| [[C box gene transcriptions|C-boxes]]
+|54. [[C box gene transcriptions|C-boxes]]
 (Song)
 || GACGTC || Y || -
 |-
-| [[C box gene transcriptions|C/A hybrid boxes]] || TGACGTAT || N || TGACGTAT<ref name=Song>{{ cite journal
+|55. [[C box gene transcriptions|C/A hybrid boxes]] || TGACGTAT || N || TGACGTAT<ref name=Song>{{ cite journal
 |author=Young Hun Song
 |author2=Cheol Min Yoo
@@ Line 540: / Line 540: @@
 |accessdate=26 March 2019 }}</ref> A at the 12 position
 |-
-| [[C box gene transcriptions|hybrid C/G-boxes]]
+|56. [[C box gene transcriptions|hybrid C/G-boxes]]
 (Song)
 || TGACGTGT || Y || -
 |-
-| [[C box gene transcriptions|C/T hybrid boxes]] || TGACGTTA || N || TGACGTTA<ref name=Song/> T at the 12 position
+|57. [[C box gene transcriptions|C/T hybrid boxes]] || TGACGTTA || N || TGACGTTA<ref name=Song/> T at the 12 position
 |-
-| [[C box gene transcriptions|C boxes]]
+|58. [[C box gene transcriptions|C boxes]]
 (Voronina)
 || GGTGATG || Y || -
 |-
-| [[CAAT box gene transcriptions|CCAAT-boxes-binding transcription factors]]
+|59. [[CAAT box gene transcriptions|CCAAT-boxes-binding transcription factors]]
 (Hap4p)
 || CCAAT || Y || -
 |-
-| [[CCCTC-binding factor gene transcriptions|CCCTC-binding factors]]
+|60. [[CCCTC-binding factor gene transcriptions|CCCTC-binding factors]]
 (CTCF)
@@ Line 580: / Line 580: @@
 |accessdate=28 August 2020 }}</ref>
 |-
-| [[C-EBP box gene transcriptions|C/EBP boxes]] || TTAGGACAT,<ref name=Misra>{{ cite journal
+|61. [[C-EBP box gene transcriptions|C/EBP boxes]] || TTAGGACAT,<ref name=Misra>{{ cite journal
 |author=Ravi P. Misra
 |author2=Azad Bonni
@@ Line 610: / Line 610: @@
 | doi = 10.1021/bi00136a019 }}</ref> || N || CCAAT-enhancer-binding site (C/EBP) is TAGCATT
 |-
-| [[Cell cycle regulation gene transcriptions|Cell cycle regulation]] || CCCAACGGT<ref name=Sharma/> || N || tomato genome-wide analysis
+|62. [[Cell cycle regulation gene transcriptions|Cell cycle regulation]] || CCCAACGGT<ref name=Sharma/> || N || tomato genome-wide analysis
 |-
-| [[CENP-B box gene transcriptions|CENP-B boxes]] || TTTCGTTGGAAGCGGGA || N || specifically localized at the centromere
+|63. [[CENP-B box gene transcriptions|CENP-B boxes]] || TTTCGTTGGAAGCGGGA || N || specifically localized at the centromere
 |-
-| [[CGCG box gene transcriptions|CGCG boxes]] || (A/C/G)CGCG(C/G/T) || Y || -
+|64. [[CGCG box gene transcriptions|CGCG boxes]] || (A/C/G)CGCG(C/G/T) || Y || -
 |-
-| [[Coupling element gene transcriptions|Coupling elements]]
+|65. [[Coupling element gene transcriptions|Coupling elements]]
 (CE)
 || TGCCACCGG<ref name=Watanabe/> || N || CE1 (Watanabe)
 |-
-| [[Circadian control element gene transcriptions|Circadian control elements]] || CAANNNNATC || Y || -
+|66. [[Circadian control element gene transcriptions|Circadian control elements]] || CAANNNNATC || Y || -
 |-
-| [[Cold-responsive element gene transcriptions|Cold-responsive elements]] || CCGAC || Y || -
+|67. [[Cold-responsive element gene transcriptions|Cold-responsive elements]] || CCGAC || Y || -
 |-
-| [[Coupling element gene transcriptions|Coupling elements]]
+|68. [[Coupling element gene transcriptions|Coupling elements]]
 (CE1s)
@@ Line 632: / Line 632: @@
 || GCGTGTC || Y || -
 |-
-| [[Coupling element gene transcriptions|Coupling elements]]
+|69. [[Coupling element gene transcriptions|Coupling elements]]
 (CE3s)
@@ Line 639: / Line 639: @@
 || CACGCG || Y || -
 |-
-|  [[CRE box gene transcriptions|cAMP-responsive elements]]
+|70.  [[CRE box gene transcriptions|cAMP-responsive elements]]
 (CREs), Aca1ps, Sko1ps
 || TGACGTCA || Y || -
 |-
-| [[DAF-16 binding element gene transcriptions|DAF-16 binding elements]] || (A/G)(C/T)AAA(C/T)A || Y || -
+|71. [[DAF-16 binding element gene transcriptions|DAF-16 binding elements]] || (A/G)(C/T)AAA(C/T)A || Y || -
 |-
-| [[DAF-16-associated element gene transcriptions|DAF-16-associated elements]]
+|72. [[DAF-16-associated element gene transcriptions|DAF-16-associated elements]]
 (DAE)
@@ Line 665: / Line 665: @@
 |accessdate=27 August 2020 }}</ref>
 |-
-| [[D box gene transcriptions|D-boxes]]
+|73. [[D box gene transcriptions|D-boxes]]
 (Mracek1)
@@ Line 690: / Line 690: @@
 |accessdate=10 February 2019 }}</ref>
 |-
-| [[D box gene transcriptions|D-boxes]]
+|74. [[D box gene transcriptions|D-boxes]]
 (Mracek)
 || CTTATGTAAA (Mracek2) || N || CTTATGTAAA<ref name=Mracek/>
 |-
-| [[D box gene transcriptions|D-boxes]]
+|75. [[D box gene transcriptions|D-boxes]]
 (Johnson)
 || TCTCACA || N || TCTCACATT(A/C)AATAAGTCA is a D-box.<ref name=Johnson/>
 |-
-| [[D box gene transcriptions|D boxes]]
+|76. [[D box gene transcriptions|D boxes]]
 (Samarsky)
 || AGTCTG || Y || -
 |-
-| [[D box gene transcriptions|D boxes]]
+|77. [[D box gene transcriptions|D boxes]]
 (Voronina)
 || TCCTG || Y || -
 |-
-| [[D box gene transcriptions|D-boxes]]
+|78. [[D box gene transcriptions|D-boxes]]
 (Motojima)
 || TGAGTGG || Y || -
 |-
-| [[Xenobiotic response element gene transcriptions|Dioxin-responsive elements]]
+|79. [[Xenobiotic response element gene transcriptions|Dioxin-responsive elements]]
 (DREs)
 || TNGCGTG || Y || -
 |-
-| [[Defense and stress-responsive element gene transcriptions|Defense and stress-responsive elements]] || ATTTTCTTCA || N || (ATTTTCTTCA)<ref name=Sharma/>
+|80. [[Defense and stress-responsive element gene transcriptions|Defense and stress-responsive elements]] || ATTTTCTTCA || N || (ATTTTCTTCA)<ref name=Sharma/>
 |-
-| [[DNA damage response element gene transcriptions|DNA damage response elements]]
+|81. [[DNA damage response element gene transcriptions|DNA damage response elements]]
 (DREs)
@@ Line 741: / Line 741: @@
 |accessdate=4 September 2020 }}</ref> || N || in the upstream repression sequence (URS)
 |-
-| [[DNA damage response element gene transcriptions|DNA damage response elements]]
+|82. [[DNA damage response element gene transcriptions|DNA damage response elements]]
 (DRE, core)
@@ Line 748: / Line 748: @@
 || CCGCC || Y || -
 |-
-| [[DNA damage response element gene transcriptions|DNA damage response elements]]
+|83. [[DNA damage response element gene transcriptions|DNA damage response elements]]
 (DREs)
@@ Line 768: / Line 768: @@
 |accessdate=6 September 2020 }}</ref> || N || in the upstream repression sequence (URS)
 |-
-| [[DNA replication-related element gene transcriptions|DNA replication-related elements]]
+|84. [[DNA replication-related element gene transcriptions|DNA replication-related elements]]
 (DREs)
@@ Line 788: / Line 788: @@
 |accessdate=4 September 2020 }}</ref>
 |-
-| [[Downstream TFIIB recognition element gene transcriptions|Downstream B recognition elements]] || (A/G)T(A/G/T)(G/T)(G/T)(G/T)(G/T) || Y || -
+|85. [[Downstream TFIIB recognition element gene transcriptions|Downstream B recognition elements]] || (A/G)T(A/G/T)(G/T)(G/T)(G/T)(G/T) || Y || -
 |-
-| [[Downstream core element gene transcriptions|Downstream core elements]]
+|86. [[Downstream core element gene transcriptions|Downstream core elements]]
 (DCEs)
 || CTTC...CTGT...AGC || Y || -
 |-
-| [[Downstream promoter element gene transcriptions|Downstream promoter elements]]
+|87. [[Downstream promoter element gene transcriptions|Downstream promoter elements]]
 (DPEs)
 || (A/G)G(A/T)(C/T)(A/C/G)T || Y || -
 |-
-| [[DREB box gene transcriptions|DREB boxes]] || TACCGACAT || N || CRT/DREB box
+|88. [[DREB box gene transcriptions|DREB boxes]] || TACCGACAT || N || CRT/DREB box
 |-
-| [[EIF4E basal element gene transcriptions|EIF4E basal elements]] || TTACCCCCCCTT || N || poly(C) motif
+|89. [[E2 box gene transcriptions|E2 boxes]] || (G/A)CAG(A/C/G/T)TG(A/C/G/T) || Y || -
 |-
-| [[Endoplasmic reticulum stress response element gene transcriptions|Endoplasmic reticulum stress response elements]]
+|90. [[EIF4E basal element gene transcriptions|EIF4E basal elements]] || TTACCCCCCCTT || N || poly(C) motif
+|-
+|91. [[EIN3 binding site gene transcriptions|EIN3 binding sites]] || A(C/T)G(A/T)A(C/T)CT || Y || -
+|-
+|92. [[Endoplasmic reticulum stress response element gene transcriptions|Endoplasmic reticulum stress response elements]]
 (ERSE)
-|| CCAAT || N || CCAATGGGCTGAAAC between ZNF497 and A1BG, compare [[A1BG response element positive results|CCAAT-box and ERSE]]
+|| CCAAT || N || CCAATGGGCTGAAAC between ZNF497 and A1BG, compare CCAAT-box and ERSE below
+|-
+|93. [[Endoplasmic reticulum stress response element gene transcriptions|Endoplasmic reticulum stress response elements]] || CCAAT-N9-CCACG, CCACG || Y || -
 |-
-| [[Estrogen response element gene transcriptions|Estrogen response elements]]
+|94. [[Endosperm expression gene transcriptions|Endosperm expressions]] || TGTGTCA || Y || -
+|-
+|95. [[Enhancer box gene transcriptions|Enhancer boxes]] || CA(A/C/G/T)(A/C/G/T)TG || Y || -
+|-
+|96. [[Estrogen response element gene transcriptions|Estrogen response elements]]
 (EREs)
 || AGGTTA or GGTCAGGAT || N || AGGTTATTGCCTCCT or GGTCAGGATGAC
 |-
-| [[I box gene transcriptions|F boxes]] || TGATAAG<ref name=Rose>{{ cite journal
+|97. [[Ethylene responsive element gene transcriptions|Ethylene responsive elements]] || ATTTCAAA || Y || -
+|-
+|98. [[I box gene transcriptions|F boxes]] || TGATAAG<ref name=Rose>{{ cite journal
 |author=Annkatrin Rose, Iris Meier and Udo Wienand
 |title=The tomato I-box binding factor LeMYBI is a member of a novel class of Myb-like proteins
@@ Line 829: / Line 841: @@
 |accessdate=8 November 2018 }}</ref> || N || F-box overlaps the I-box
 |-
-| [[Forkhead box gene transcriptions|Forkhead boxes]] || GTAAACAA<ref name=Yoshihara>{{ cite journal
+|99. [[Forkhead box gene transcriptions|Forkhead boxes]] || GTAAACAA<ref name=Yoshihara>{{ cite journal
 |author=Eiji Yoshihara
 |title=TXNIP/TBP-2: A Master Regulator for Glucose Homeostasis
@@ Line 844: / Line 856: @@
 |accessdate=5 September 2020 }}</ref> || N || GTAAACAA FOXO1
 |-
-| [[Gal4p gene transcriptions|Gal4ps]] || CGGACCGC || N || CGG(A/G)NN(A/G)C(C/T)N(C/T)NCNCCG<ref name=Tang>{{ cite journal
+|100. [[Forkhead box gene transcriptions|Forkhead boxes]] || (A/G)(C/T)AAA(C/T)A || Y || -
+|-
+|101. [[GAAC element gene transcriptions|GAAC elements]] || GAACT || Y || -
+|-
+|102. [[Gal4p gene transcriptions|Gal4ps]] || CGGACCGC || N || CGG(A/G)NN(A/G)C(C/T)N(C/T)NCNCCG<ref name=Tang>{{ cite journal
 |author=Hongting Tang, Yanling Wu, Jiliang Deng, Nanzhu Chen, Zhaohui Zheng, Yongjun Wei, Xiaozhou Luo, and Jay D. Keasling
 |title=Promoter Architecture and Promoter Engineering in ''Saccharomyces cerevisiae''
@@ Line 859: / Line 875: @@
 |accessdate=18 September 2020 }}</ref>
 |-
-| [[GARE gene transcriptions|Gibberellin responsive element-like 2]]
+|103. [[Γ-interferon activated sequence gene transcriptions|γ-interferon activated sequences]]
+(GAS)
+|| TTCCTAGAA || N || ALS-GAS1 between nt −633 and nt −625
+|-
+|104. [[Γ-interferon activated sequence gene transcriptions|Γ-interferon activated sequences]]
+(GAS), see STAT5
+|| TTNCNNNAA || Y || -
+|-
+|105. [[GATA gene transcriptions|GATA boxes]] || GATA || Y || -
+|-
+|106. [[G box gene transcriptions|G boxes]] || (G/T)CCACGTG(G/T)C || N || no "perfect palindrome" G boxes in either promoter
+|-
+|107. [[GC box gene transcriptions|GC boxes]] || (G/T)(G/A)GGCG(G/T)(G/A)(G/A)(C/T) || Y || -
+|-
+|108. [[AGC box gene transcriptions|GCC boxes]] || GCCGCC || Y || -
+|-
+|109. [[Gcn4p gene transcriptions|General control nonderepressible 4 protein binding site]]
+(GCRE, GCN4)
+|| TGA(C/G/T)T(A/C/G)(A/T) || Y || -
+|-
+|110. [[GLM box gene transcriptions#GCN4 motifs|GCN4 motifs]] || TGACTCA, TGAGTCA || N || ACGT motif
+|-
+|111. [[Gcn4p gene transcriptions|Gcn4ps]] || ATGACTCTT<ref name=Tang/> || N || [[GLM box gene transcriptions#GCN4 motifs|GCN4 motifs]]
+|-
+|112. [[GARE gene transcriptions|Gibberellic acid responsive elements]]
+(GAREs)
+|| TAACAAA || Y || -
+|-
+|113. [[Gibberellin responsive element gene transcriptions|Gibberellin responsive elements]]
+(GAREs)
+(Sharma)
+|| AAACAGA<ref name=Sharma>{{ cite journal
+|author=Bhaskar Sharma
+|author2=Joemar Taganna
+|title=Genome-wide analysis of the U-box E3 ubiquitin ligase enzyme gene family in tomato
+|journal=Scientific Reports
+|date=12 June 2020
+|volume=10
+|issue=9581
+|pages=
+|url=https://www.nature.com/articles/s41598-020-66553-1
+|arxiv=
+|bibcode=
+|doi=10.1038/s41598-020-66553-1
+|pmid=32533036
+|accessdate=27 August 2020 }}</ref> || Y || -
+|-
+|114. [[GARE gene transcriptions|GARE-like 1]]
+(Fan)
+|| TAACA(A/G)A<ref name=Fan>{{ cite journal
+|author=Liu-Min Fan, Xiaoyan Feng, Yu Wang and Xing Wang Deng
+|title=Gibberellin Signal Transduction in Rice
+|journal=Journal of Integrative Plant Biology
+|date=2007
+|volume=49
+|issue=6
+|pages=731−741
+|url=https://onlinelibrary.wiley.com/doi/pdf/10.1111/j.1744-7909.2007.00511.x
+|arxiv=
+|bibcode=
+|doi=10.1111/j.1744-7909.2007.00511.x
+|pmid=
+|accessdate=16 October 2018 }}</ref> || Y || -
+|-
+|115. [[GARE gene transcriptions|Gibberellin responsive element-like 2]]
 (GARE-like 2)
+(Fan)
 || TAACGTA<ref name=Fan>{{ cite journal
 |author=Liu-Min Fan, Xiaoyan Feng, Yu Wang and Xing Wang Deng
@@ Line 877: / Line 966: @@
 |accessdate=16 October 2018 }}</ref> || N || "in the promoters of hydrolase genes".<ref name=Fan/>
 |-
-| [[G box gene transcriptions|G boxes]] || (G/T)CCACGTG(G/T)C || N || no "perfect palindrome" G boxes in either promoter
+|116. [[GLM box gene transcriptions|GLM boxes]] || (G/A)TGA(G/C)TCA(T/C) || N || GCN4-like motif
 |-
-| [[GLM box gene transcriptions#GCN4 motifs|GCN4 motifs]] || TGACTCA, TGAGTCA || N || ACGT motif
+|117. [[Gcr1p gene transcriptions|G-protein-coupled receptors]]
+(GCR1s), CT boxes
+|| CTTCC || Y || -
 |-
-| [[Gcn4p gene transcriptions|Gcn4ps]] || ATGACTCTT<ref name=Tang/> || N || [[GLM box gene transcriptions#GCN4 motifs|GCN4 motifs]]
+|118. [[Glucocorticoid response element gene transcriptions|Glucocorticoid response elements]] || AGAACA || Y || -
 |-
-| [[GLM box gene transcriptions|GLM boxes]] || (G/A)TGA(G/C)TCA(T/C) || N || GCN4-like motif
+|119. [[Grainy head transcription factor gene transcriptions|Grainy head transcription factor binding sites]] || AACCGGTT || N || also GACTGGTT
 |-
-| [[Γ-interferon activated sequence gene transcriptions|γ-interferon activated sequences]]
+|120. [[TC element gene transcriptions|GT boxes]]
-(GAS)
+(Motojima)
-|| TTCCTAGAA || N || ALS-GAS1 between nt −633 and nt −625
+|| TGGGTGGGGCT || N || (-78 to -69)
 |-
-| [[Grainy head transcription factor gene transcriptions|Grainy head transcription factor binding sites]] || AACCGGTT || N || also GACTGGTT
+|121. [[TC element gene transcriptions|GT boxes]]
+(Sato)
+|| GGGG(T/A)GGGG || Y || Negative strand, Positive direction: GGGGAGGGG at 2291
 |-
-| [[TC element gene transcriptions|GT boxes]]
+|122. [[Hac1p gene transcriptions|Hac1]] ''KAR2'' || CAGCGTG || Y || Positive strand, negative direction: CAGCGTG at 740, Negative strand, positive direction: CACGCTG at 778
-(Motojima)
-|| TGGGTGGGGCT || N || (-78 to -69)
 |-
-| [[H and ACA box gene transcriptions|H and ACA boxes]] || AGAGGA || Y || -
+|123. [[H and ACA box gene transcriptions|H and ACA boxes]] || AGAGGA || Y || -
 |-
-| [[Middle sporulation element gene transcriptions|Hapless motifs]] || CCAATCA || N || heterotrimeric transcription factor, HAP2/3/4.<ref name=Ozsarac>{{ cite journal
+|124. [[Middle sporulation element gene transcriptions|Hapless motifs]] || CCAATCA || N || heterotrimeric transcription factor, HAP2/3/4.<ref name=Ozsarac>{{ cite journal
 | author = Nesrin Ozsarac, Melissa J. Straffon, Hazel E. Dalton, and Ian W. Dawes
 | title = Regulation of Gene Expression during Meiosis in ''Saccharomyces cerevisiae'': ''SPR3'' Is Controlled by both ABFI and a New Sporulation Control Element
@@ Line 911: / Line 1,003: @@
 | doi = 10.1128/MCB.17.3.1152 }}</ref>
 |-
-| [[Heat-responsive element gene transcriptions|Heat-responsive elements]] || AAAAAATTTC || N || four nGAAn motifs
+|125. [[H box gene transcriptions|H boxes]]
+(Lindsay)
+|| CCTACC || Y || -
 |-
-| [[Hsf1p gene transcriptions|Heat shock elements]]
+|126. [[H box gene transcriptions|H box]]
+(Mitchell)
+|| ANANNA || Y || -
+|-
+|127. [[H box gene transcriptions|H box]]
+(Rozhdestvensky)
+|| ACACCA || Y || -
+|-
+|128. [[Heat-responsive element gene transcriptions|Heat-responsive elements]] || AAAAAATTTC || N || four nGAAn motifs
+|-
+|129. [[Hsf1p gene transcriptions|Heat shock elements]]
+(HSEs)
+(Eastmond)
+|| nGAAn-(5-bp)-nGAAnnTTCn || Y || Negative strand, positive direction: GGAATTCACATGAACCTTCA at 332
+|-
+|130. [[Hsf1p gene transcriptions|Heat shock elements]]
+(HSEs)
+(Eastmond)
+|| nGA(A/G)n-(5-bp)-nGAAnnTTCn (GAP) || Y || Negative strand, positive direction: GGAATTCACATGAACCTTCA at 332
+|-
+|131. [[Hsf1p gene transcriptions|Heat shock elements]]
+(HSEs)
+(Eastmond)
+|| nGAAn-(5-bp)-nGA(A/G)nnTTCn (GAP) || Y || Negative strand, negative direction: GGAATTCACATGAACCTTCA at 332
+|-
+|132. [[Hsf1p gene transcriptions|Heat shock elements]]
+(HSEs)
+(Eastmond)
+|| nGAAn-(5-bp)-nGAAn-(5-bp)-nGAAn || Y || Postive strand, negative direction: AGAAGAAAAAAGAAAAGAGAAGAAA at 2831
+|-
+|133. [[Hsf1p gene transcriptions|Heat shock elements]]
 (HSE1)
@@ Line 920: / Line 1,055: @@
 || nGAAnnTTCnnGAAn || N || HSE1
 |-
-| [[Hsf1p gene transcriptions|Heat shock elements]]
+|134. [[Hsf1p gene transcriptions|Heat shock elements]]
 (HSE2)
@@ Line 927: / Line 1,062: @@
 || nTTCnnGAAnnTTCn || N || HSE2 is the inverse complement of HSE1
 |-
-| [[Hsf1p gene transcriptions|Heat shock elements]]
+|135. [[Hsf1p gene transcriptions|Heat shock elements]]
 (HSE5)
@@ Line 934: / Line 1,069: @@
 || nTTCn-(5-bp)-nTTCnnGAAn || N || HSE5
 |-
-| [[Hsf1p gene transcriptions|Heat shock elements]]
+|136. [[Hsf1p gene transcriptions|Heat shock elements]]
 (HSE6)
@@ Line 941: / Line 1,076: @@
 || nTTCn-nnGAAn-(5-bp)-nGAAn || N || HSE6
 |-
-| [[Hsf1p gene transcriptions|Heat shock elements]]
+|137. [[Hsf1p gene transcriptions|Heat shock elements]]
 (HSE7)
@@ Line 948: / Line 1,083: @@
 || nGA(A/G)nnTTCnnGAAn || N || HSE7 PFT1
 |-
-| [[Hsf1p gene transcriptions|Heat shock elements]]
+|138. [[Hsf1p gene transcriptions|Heat shock elements]]
 (HSE)
@@ Line 955: / Line 1,090: @@
 || nGAAnnTTCnnGA(A/G)n || N || HSE7 PFT2
 |-
-| [[Hsf1p gene transcriptions|Heat shock elements]]
+|139. [[Hsf1p gene transcriptions|Heat shock elements]]
 (HSE10)
@@ Line 962: / Line 1,097: @@
 ||  nTTCn-(11-bp)-nGAAn-(5 bp)-nGAAn || N || HSE10
 |-
-| [[Hypoxia-inducible factor gene transcriptions|Hypoxia-inducible factors]] || GCCCTACGTGCTGTCTCA<ref name=Li2020>{{ cite journal
+|140. [[Hex sequence gene transcriptions|Hex sequences]] || TGACGTGGC || Y || Positive strand, positive direction: TGACGTGGC at 4344
+|-
+|141. [[HMG box gene transcriptions|High Mobility Group boxes]]
+(HMG boxes)
+|| (A/T)(A/T)CAAAG || Y || Positive strand, negative direction: ATCAAAG at 2891
+|-
+|142. [[HNF gene transcriptions|HNF6s]] || (A/G/T)(A/T)(A/G)T(C/T)(A/C/G)AT(A/C/G/T)(A/G/T) || Y || Positive strand, negative direction: TTATTAATTC at 4542, TTATTAATCG at 4229, TAGTTGATAA at 3527
+|-
+|143. [[Homeobox gene transcriptions|Homeoboxes]] || CAAG || Y || -
+|-
+|144. [[HY box gene transcription laboratory|HY boxes]] || TG(A/T)GGG || Y || Negative strand, negative direction: CCCTCA at 4498, CCCTCA at 3889, CCCACA at 3184
+Positive strand, negative direction: TGAGGG at 4558, TGTGGG at 3712, TGAGGG at 3652
+|-
+|145. [[Hypoxia-inducible factor gene transcriptions|Hypoxia-inducible factors]] || GCCCTACGTGCTGTCTCA<ref name=Li2020>{{ cite journal
 |author=Qingliang Li, Rezaul M. Karim, Mo Cheng, Mousumi Das, Lihong Chen, Chen Zhang, Harshani R. Lawrence, Gary W. Daughdrill, Ernst Schonbrunn, Haitao Ji and Jiandong Chen
 |title=Inhibition of p53 DNA binding by a small molecule protects mice from radiation toxicity
@@ Line 977: / Line 1,127: @@
 |accessdate=29 August 2020 }}</ref> || N || composed of HIF-1α and HIF-1β
 |-
-| [[I box gene transcriptions|I boxes]] || GATAAG || N || GGATGAGATAAGA
+|146. [[ABA-response element gene transcriptions|Hypoxia response elements]] || ACGTG || Y || Negative strand: ACGTG at 4339, CACGT at 3429, ACGTG at 3288, CACGT at 2863
+Positive strand: ACGTG at 4237
+|-
+|147. [[I box gene transcriptions|I boxes]] || GATAAG || N || GGATGAGATAAGA
 |-
-| [[Inositol, choline-responsive element gene transcriptions|Inositol, choline-responsive elements]]
+|148. [[Initiator element gene transcriptions|Initiator elements]]
+(Inrs)
+|| YYANWYY || Y || Negative strand, negative direction: TTACTCC at 4557, TCACACT at 4361, TCGGACC at 4349, CCAGTTT at 4309, TCGGACC at 4300, GGTCCGA at 4255, CTGCACC at 4238, TCGGTCT at 4233
+Positive strand, negative direction: GGAATGA at 4555, TTAATTC at 4542, TCACATT at 4533, AGTCCAA at 4502, CCACTTT at 4461, CCACTCC at 4425, CCACTCC at 4425, CCAGTTC at 4417, AGTGTGA at 4361, CTGCACT at 4340, CCGGACT at 4327, AAAATAA at 4221
+|-
+|149. [[Initiator element gene transcriptions|Initiator elements]]
+(Inrs)
+|| BBCABW || Y || Negative strand, negative direction: TCTGGG at 4366, GTCACA at 4359, CCCACT at 4353, TGTGAC at 4336, GTCACT at 4319, TCCAGT at 4307, TCTGCA at 4236
+Positive strand, negative direction: AATGAG at 4556, TTCACA at 4531, CCCACT at 4485, TCCACT at 4459, CCCAGA at 4448, TCCACT at 4423, GCCAGT at 4415, TGCACT at 4340, TGCAGT at 4317, GCCAGA at 4233
+|-
+|150. [[Initiator element gene transcriptions|Initiator-like elements]] || TTCTCT || Y || Negative strand: AGAGAA at 4527, TTCTCT at 3380
+|-
+|151. [[Inositol, choline-responsive element gene transcriptions|Inositol/choline-responsive elements]]
 (ICRE)
@@ Line 986: / Line 1,156: @@
 || CANNTGAAAT || N || version of Lopes, see below
 |-
-| [[Inositol, choline-responsive element gene transcriptions|Inositol, choline-responsive elements]]
+|152. [[Inositol, choline-responsive element gene transcriptions|Inositol/choline-responsive elements]]
+(ICRE)
+(Case, Lopes)
+|| CATGTGAAAT includes the canonical basic helix-loop-helix (bHLH) binding site CANNTG (Lopes et al. 1991) || Y || -
+|-
+|153. [[Inositol, choline-responsive element gene transcriptions|Inositol/choline-responsive elements]]
 (ICRE)
@@ Line 993: / Line 1,170: @@
 || ATGTGAAAT || N || using ANNTGAAAT
 |-
-| [[Kozak sequence gene transcriptions|Kozak sequences]] || GCCGCC(A/G)CCATGG || N || GCCGCC(A/G)CCATGG<ref name=Kozak1987>{{ cite journal
+|154. [[Inositol, choline-responsive element gene transcriptions|Inositol/choline-responsive elements]]
+(ICREs)
+(Schwank)
+|| TYTTCACATGY contains the core sequence CANNTG || Y || -
+|-
+|155. [[Interferon regulatory factor gene transcriptions|Interferon regulatory factor]]
+(IFF3)
+|| GCTTTCC || Y || -
+|-
+|156. [[Jasmonic acid-responsive element gene transcriptions|Jasmonic acid-responsive elements]]
+(JAREs)
+|| TGACG || Y || -
+|-
+|157. [[Kozak sequence gene transcriptions|Kozak sequences]] || GCCGCC(A/G)CCATGG || N || GCCGCC(A/G)CCATGG<ref name=Kozak1987>{{ cite journal
 |author=Marilyn Kozak
 |date=October 1987
@@ Line 1,005: / Line 1,198: @@
 |pmid=3313277 }}</ref>
 |-
-| [[Kozak sequence gene transcriptions|Kozak sequences]]
+|158. [[Kozak sequence gene transcriptions|Kozak sequences]]
 (Matsumoto)
@@ Line 1,029: / Line 1,222: @@
 |accessdate=27 September 2020 }}</ref>
 |-
-| [[L box gene transcriptions|L boxes]] || AAATTAACCAA || N || AAATTAACCAA<ref name=Donald>{{ cite journal
+|159. [[Krüppel-like factor gene transcriptions|Krüppel-like factors]] || GGGNN(G/T)(G/T)(G/T) || Y || -
+|-
+|160. [[L box gene transcriptions|L boxes]] || AAATTAACCAA || N || AAATTAACCAA<ref name=Donald>{{ cite journal
 |author=Robert G. K. Donald and Anthony R. Cashmore
 |title=Mutation of either G box or I box sequences profoundly affects expression from the ''Arabidopsis rbcS‐1A'' promoter
@@ Line 1,044: / Line 1,239: @@
 |accessdate=8 November 2018 }}</ref>
 |-
-| [[Maf recognition element gene transcriptions|Maf recognition element]]
+|161. [[M35 box gene transcriptions|-35 sequence]] || TTGACA || Y || Negative strand: TTGACA at 4399
+|-
+|162. [[Maf recognition element gene transcriptions|Maf recognition element]]
 (MAREs)
@@ Line 1,062: / Line 1,259: @@
 |accessdate=8 September 2020 }}</ref>
 |-
-| [[M box gene transcriptions|M boxes]] || GTCATGTGCT || N || or AGTCATGTGCT<ref name=Bertolotto>{{ cite journal
+|163. [[M box gene transcriptions|M boxes]] || GTCATGTGCT || N || or AGTCATGTGCT<ref name=Bertolotto>{{ cite journal
 |author=Corine Bertolotto, Roser Buscà, Patricia Abbe, Karine Bille, Edith Aberdam, Jean-Paul Ortonne, and Robert Ballotti
 |title=Different ''cis''-Acting Elements Are Involved in the Regulation of TRP1 and TRP2 Promoter Activities by Cyclic AMP: Pivotal Role of M Boxes (GTCATGTGCT) and of Microphthalmia
@@ Line 1,077: / Line 1,274: @@
 |accessdate=8 December 2018 }}</ref>
 |-
-| [[Mcm1 regulatory factor gene transcriptions|Mcm1 regulatory factors]] || TT(A/T)CCNN(A/T)TNGG(A/T)AA || N || Primary consensus sequence apparently: TT(A/T)CCNN(A/T)TNGG(A/T)AA.<ref name=Rossi/>
+|164. [[Mcm1 regulatory factor gene transcriptions|Mcm1 regulatory factors]] || TT(A/T)CCNN(A/T)TNGG(A/T)AA || N || Primary consensus sequence apparently: TT(A/T)CCNN(A/T)TNGG(A/T)AA.<ref name=Rossi/>
 |-
-| [[Motif ten element gene transcriptions|Motif ten elements]] || C(C/G)A(A/G)C(C/G)(C/G)AACG(C/G) || N || Gene ID: 6309
+|165. [[Met31p box gene transcriptions|Met31ps]] || AAACTGTG<ref name=Blaiseau>{{ cite journal
+|author=Pierre‐Louis Blaiseau and Dominique Thomas
+|title=Multiple transcriptional activation complexes tether the yeast activator Met4 to DNA
+|journal=The EMBO Journal
+|date=2 November 1998
+|volume=17
+|issue=
+|pages=6327-6336
+|url=
+|arxiv=
+|bibcode=
+|doi=10.1093/emboj/17.21.6327
+|pmid=
+|accessdate=4 February 2021 }}</ref> || Y || Positive strand, negative direction: AAACTGTG at 4400
 |-
-| [[Nuclear factor gene transcriptions|NF‐κB/Rel family of eukaryotic transcription factors]] || CCCCTAAGGGG || N || [[NF-κB]]
+|166. [[Metal responsive element gene transcriptions|Metal responsive elements]]
+(MRE)
+|| TGC(A/G)C(A/C/G/T)C || Y || Positive strand: TGCACTC at 4341, TGCACTC at 3290, GTGTGCA at 2863
 |-
-| [[Nuclear factor gene transcriptions|Nuclear factor 1]]
+|167. [[Middle sporulation element gene transcriptions|Middle sporulation element]]
+(MSE)
+(Branco)
+|| ACACAAA || Y || Negative strand, negative direction: TTTGTGT at 3513
+|-
+|168. [[Middle sporulation element gene transcriptions|Midsporulation element]]
+(MSE)
+(Ozsarac)
+|| C(A/G)CAAA(A/T) || Y ||Negative strand, negative direction: TTTTGTG at 3512
+Positive strand, negative direction: CACAAAA at 3767
+|-
+|169. [[Mig1p gene transcriptions|Multicopy inhibitor of the ''GAL1'' promoter]]
+(''MIG1'')
+|| (C/G)(C/T)GGGG || Y || Negative strand, negative direction: GTGGGG at 4445, GTGGGG at 3058
+Positive strand, negative direction: CCCCAG at 4447, CTGGGG at 3037
+|-
+|170. [[Motif ten element gene transcriptions|Motif ten elements]] || C(C/G)A(A/G)C(C/G)(C/G)AACG(C/G) || N || Gene ID: 6309
+|-
+|171. [[MYB recognition element gene transcriptions|Myeloblastosis recognition element]]
+(MRE)
+|| A(A/C)C(A/T)A(A/C)C || Y || Negative strand: GGTAGGT at 4457, ACCAACC at 3946, ACCAACC at 3606, GGTTGTT at 3139
+|-
+|172. [[Myocyte enhancer factor gene transcriptions|Myocyte enhancer factors]]
+(MEFs)
+|| (C/T)TA(A/T)(A/T)(A/T)(A/T)TA(A/G) || Y || Negative strand, negative direction: TTATTATTAA at 4226
+|-
+|173. [[Ndt80p gene transcriptions|Non-DiTyrosine 80 transcription factor DNA binding domain]]
+(Ndt80)
+|| (A/G/T)NC(A/G)CAAA(A/T) || Y || Negative strand, negative direction: TTTTGTGTT at 3514
+Positive strand: ACCACAAAA at 3767
+|-
+|174. [[Nuclear factor gene transcriptions|NF‐κB/Rel family of eukaryotic transcription factors]] || CCCCTAAGGGG || N || [[NF-κB]]
+|-
+|175. [[Nuclear factor gene transcriptions|Nuclear factor 1]]
 (NF-1)
 || TTGGCNNNNNGCCAA || N || palindromic sequence
 |-
-| [[Nuclear factor Y gene transcriptions|Nuclear factor Ys]] || CCAATGG(A/C)(A/G) || N || NF-Y is a trimeric complex
+|176. [[Nuclear factor of activated T cell gene transcriptions (NFAT)|Nuclear factor of activated T cells]]
+(NFATs)
+|| GGAAAA || Y || Negative strand, negative direction: TTTTCC at 3441, TTTTCC at 3345
+Positive strand, negative direction: GGAAAA at 2968, GGAAAA at 2927
+|-
+|177. [[Nuclear factor Y gene transcriptions|Nuclear factor Ys]] || CCAATGG(A/C)(A/G) || N || NF-Y is a trimeric complex
+|-
+|178. [[Nutrient-sensing response element gene transcriptions|Nutrient-sensing response element 1]] || GTTTCATCA || Y || -
+|-
+|179. [[Oaf1p gene transcriptions|Oaf1 transcription factor]] || CGGN<sub>3</sub>TNAN<sub>9-12</sub>CCG || Y || -
+|-
+|180. [[ORE1 binding site gene transcriptions|ORESARA1]]
+(ORE1)
+(Matallana)
+|| (A/C/G)(A/C)GT(A/G)N<sub>5,6</sub>(C/T)AC(A/G) || Y || Negative strand, negative direction: GCGTAGAAGACACA at 3558, AAGTAGTTTCTACG at 2895
+|-
+|181. [[ORE1 binding site gene transcriptions|ORESARA1]]
+(ORE1)
+(Olsen)
+|| T(A/G/T)(A/G)CGT(A/G)(A/C/T)(A/G/T) || Y || Negative strand, negative direction: TGACGTGAG at 4341, TAACGTGAG at 3290
+Positive strand, negative direction: ATCACGCCA at 3282
 |-
-| [[P63 DNA-binding site gene transcriptions|p63 DNA binding sites]] || (A/G)(A/G)(A/G)C(A/G)(A/T)G(C/T)(C/T)(C/T)(A/G)(A/G)(A/G)C(A/T)(C/T)G(C/T)(C/T)(C/T) || N || RRRC(A/G)(A/T)GYYYRRRC(A/T)(C/T)GYYY
+|182. [[P53 response element gene transcriptions|p53 response elements]] || (A/G)(A/G)(A/G)C(A/T)(A/T)G(C/T)(C/T)(C/T) || Y || Negative, negative direction: AGACAAGCTT at 4186
 |-
-| [[Pdr1,3p gene transcriptions|Pdr1p/Pdr3ps]] || TCCGCGGA || N || Pdr1p/Pdr3p response elements (PDREs)
+|183. [[P63 DNA-binding site gene transcriptions|p63 DNA binding sites]] || (A/G)(A/G)(A/G)C(A/G)(A/T)G(C/T)(C/T)(C/T)(A/G)(A/G)(A/G)C(A/T)(C/T)G(C/T)(C/T)(C/T) || N || RRRC(A/G)(A/T)GYYYRRRC(A/T)(C/T)GYYY
 |-
-| [[Peroxisome proliferator hormone response element gene transcriptions|Peroxisome proliferator hormone response elements]]
+|184. [[P box gene transcriptions|P-box (Mena)]] || (A/T)AAAG || Y || Negative strand, negative direction: CTTTT at 4395, CTTTT at 4390, CTTTT at 4383, TAAAG at 3688, TAAAG at 2884
+Positive strand, negative direction: AAAAG at 4391, AAAAG at 4386, AAAAG at 4379, AAAAG at 3440, AAAAG at 3344, CTTTT at 3019, TAAAG at 2857
+|-
+|185. [[P box gene transcriptions|P-box]]
+(Motojima)
+|| TGAGTTCA || Y || -
+|-
+|186. [[P box gene transcriptions|P-box]]
+(Yu)
+|| GTAA(T/C) || Y || Negative strand, negative direction: ATTAC at 3658, GTAAT at 3436, GTAAC at 3285, GTAAT at 2951
+Positive strand, negative direction: GTAAT at 3973, ATTAC at 3469, GTAAT at 3064
+|-
+|187. [[Pdr1,3p gene transcriptions|Pdr1p/Pdr3ps]] || TCCGCGGA || N || Pdr1p/Pdr3p response elements (PDREs)
+|-
+|188. [[Peroxisome proliferator hormone response element gene transcriptions|Peroxisome proliferator-activated receptor alpha]] || CGACCCC || Y || Negative strand, negative direction: CGACCCC at 3037
+|-
+|189. [[Peroxisome proliferator hormone response element gene transcriptions|Peroxisome proliferator hormone response elements]]
 (PPREs)
 || AGGTCANAGGTCA || N || PPARs/RXRs heterodimers bind to PPRE
 |-
-| [[Pollen1 element gene transcriptions|Pollen1 with TCCACCATA]] || AGAAANNNNTCCACCATA || N || adjacent co-dependent regulatory element TCCACCATA
+|190. [[Phosphate starvation-response transcription factor gene transcriptions|Pho4ps]] || CAC(A/G)T(T/G) || Y || Negative strand, negative direction: TTACAC at 4091, AACGTG at 3288, CACGTT at 2864
+Positive strand, negative direction: CACATT at 4533
+|-
+|191. [[Pollen1 element gene transcriptions|Pollen1 elements]] || AGAAA || Y || Negative strand, negative direction: TTTCT at 4505, TTTCT at 4392, TTTCT at 4387, TTTCT at 4380, TTTCT at 4083, TTTCT at 3924, TTTCT at 3665, TTTCT at 3378, TTTCT at 2892
+Positive strand, negative direction: AGAAA at 4394, AGAAA at 4389, AGAAA at 4382, AGAAA at 4085, AGAAA at 4081, AGAAA at 3591, AGAAA at 3376, AGAAA at 3342
+|-
+|192. [[Pollen1 element gene transcriptions|Pollen1 with TCCACCATA]] || AGAAANNNNTCCACCATA || N || adjacent co-dependent regulatory element TCCACCATA
+|-
+|193. [[Polycomb response element gene transcriptions|Polycomb response elements]] || CGCCAT(A/T)TT || N || CGCCATTT
+|-
+|194. [[Polycomb response element gene transcriptions|Polycomb response elements]]
+(PRE)
+|| GCCAT || Y || Positive strand, negative direction: GCCAT at 3685, ATGGC at 3629, GCCAT at 3283, ATGGC at 3005, ATGGC at 2907
+|-
+|195. [[Pribnow box gene transcriptions|Pribnow boxes]] || TATAAT || Y || Negative strand, negative direction: TATAAT at 3468, TATAAT at 3454
+|-
+|196. [[Prolamin box gene transcriptions|Prolamin boxes]] || TG(A/T)AAAG || Y || Negative strand, negative direction: TGTAAAG at 2884
+|-
+|197. [[Pyrimidine box gene transcriptions|Pyrimidine boxes]] || CCTTTT || Y || Negative strand, negative direction: CCTTTT at 2968, CCTTTT at 2927
+Positive strand, negative direction: AAAAGG at 3441, AAAAGG at 3345
+|-
+|198. [[Q element gene transcriptions|Q elements]]
+See [[Retinoic acid response element gene transcriptions|Retinoic acid response element]]
+|| AGGTCA || Y || Positive strand, negative direction: AGGTCA at 4307
+|-
+|199. [[Xenobiotic response element gene transcriptions|Quinone reductase response element]]
+(QRDRE)
+(Yao)
+|| TCCCCT of TCCCCTTGCGTG || Y || -
+|-
+|200. [[Rap1 regulatory factor gene transcriptions|Rap1 regulatory factors]] || ACCC(A/G)N(A/G)CA || N || "(ACCCRnRCA), less than half of the sites were detectably bound"<ref name=Rossi/>
+|-
+|201. [[Rap1 regulatory factor gene transcriptions|Rap1 reduced consensus]] || (A/G)(A/C)ACCC(A/G)N(A/G)C(A/C)(C/T)(A/C) || Y || Positive strand, positive direction: GAACCCACACCTC at 1807
+|-
+|202. [[Reb1 general regulatory factor gene transcriptions|Reb1 bound and exact occurrences]] || TTACCC(G/T) || Y || Negative strand, negative direction: TTACCCT at 3661
+|-
+|203. [[Reb1 general regulatory factor gene transcriptions|Extended Reb1]] || ATTACCCGAA || N || "extended motif VTTACCCGNH (IUPAC nomenclature) (Rhee and Pugh 2011)."<ref name=Rossi/>
+|-
+|204. [[Retinoic acid response element gene transcriptions|Retinoic acid response element]] || AG(A/G)TCA || Y || Negative strand, negative direction: TGATCT at 3463
+|-
+|205. [[Rgt1p gene transcriptions|Glucose transporter gene repressor]]
+(Rgt1)
+|| CGG(A/G)(A/T)N(A/T)(A/T) || Y || Negative strand, negative direction: ATTTTCCG at 3442
+|-
+|206. [[Rlm1p gene transcriptions|Rlm1ps]] || CTATATATAG || N || CTA(T/A)<sub>4</sub>TAG
 |-
-| [[Polycomb response element gene transcriptions|Polycomb response elements]] || CGCCAT(A/T)TT || N || CGCCATTT
+|207. [[ROR-response element gene transcriptions|classic RORE motif]]
+(RORE)
+|| A(A/T)NTAGGTCA || Y || -
 |-
-| [[Rap1 regulatory factor gene transcriptions|Rap1 regulatory factors]] || ACCC(A/G)N(A/G)CA || N || "(ACCCRnRCA), less than half of the sites were detectably bound"<ref name=Rossi/>
+|208. [[ROR-response element gene transcriptions|variant RORE motif]] || C(T/A)(G/A)GGNCA || Y || Negative strand, negative direction: CTGGGACA at 4369, CTGGGACA at 4208
 |-
-| [[Reb1 general regulatory factor gene transcriptions|Extended Reb1]] || ATTACCCGAA || N || "extended motif VTTACCCGNH (IUPAC nomenclature) (Rhee and Pugh 2011)."<ref name=Rossi/>
+|209. [[Rox1p gene transcriptions|Rox1ps]] || RRRTAACAAGAG || N || Heme-dependent repressor of hypoxic genes.<ref name=Tang/>
 |-
-| [[Rlm1p gene transcriptions|Rlm1ps]] || CTATATATAG || N || CTA(T/A)<sub>4</sub>TAG
+|210. [[Rpn4p gene transcriptions|Rpn4ps]] || GGTGGCAAA || N || proteasome genes
 |-
-| [[Rox1p gene transcriptions|Rox1ps]] || RRRTAACAAGAG || N || Heme-dependent repressor of hypoxic genes.<ref name=Tang/>
+|211. [[MYB recognition element gene transcriptions|R response elements]]
+(RRE)
+|| CATCTG || Y || Negative strand, negative direction: CAGATG at 4212, CAGATG at 2988
+Positive strand, negative direction: CAGATG at 3919, CAGATG at 3627, CAGATG at 3620
 |-
-| [[Rpn4p gene transcriptions|Rpn4ps]] || GGTGGCAAA || N || proteasome genes
+|212. [[Seed-specific element gene transcriptions|Seed-specific elements]] || CATGCATG || N || SRE consensus: CAGCAGATTGCG is none
 |-
-| [[Seed-specific element gene transcriptions|Seed-specific elements]] || CATGCATG || N || SRE consensus: CAGCAGATTGCG is none
+|213. [[Serum response element gene transcriptions|Serum response elements]]
+(SRE)
+see [[CArG box gene transcriptions|CArG boxes]]
+|| ACAGGATGT || Y || Negative strand, positive direction: ACAGGATGT at 3575
 |-
-| [[Shoot specific element gene transcriptions|Shoot specific elements]] || GATAATGATG || ⌘F || SRE consensus: CAGCAGATTGCG is none
+|214. [[Servenius sequence gene transcriptions|Servenius sequences]] || GGACCCT || Y || Negative strand, negative direction: GGACCCT at 4548, GGACCCT at 4496, GGACCCT at 4302
 |-
-| [[Sip4p gene transcriptions|Sip4ps]] || CCGTCCGT || ⌘F || CC(C/G)T(C/T)C(C/G)TCCG
+|215. [[Shoot specific element gene transcriptions|Shoot specific elements]] || GATAATGATG || N || SRE consensus: CAGCAGATTGCG is none
 |-
-| [[Smp1p gene transcriptions|Smp1ps]] || ACTACTA || ⌘F || 5-ACTACTA(T/A)4TAG
+|216. [[Sip4p gene transcriptions|Sip4ps]] || CCGTCCGT || ⌘F || CC(C/G)T(C/T)C(C/G)TCCG
 |-
-| [[Sterol response element gene transcriptions|Sterol response elements]] || TCGTATA || ⌘F || perhaps plant specific
+|217. [[Smp1p gene transcriptions|Smp1ps]] || ACTACTA || ⌘F || 5-ACTACTA(T/A)4TAG
+|-
+|218. [[STAT5 gene transcription laboratory|STAT5]] || TTCNNNGAA || Y || Positive strand, negative direction: TTCCCTGAA at 3782, TTCGTTGAA at 3506
+|-
+|219. [[Sterol response element gene transcriptions|Sterol response elements]] || TCGTATA || ⌘F || perhaps plant specific
+|-
+|220. [[Msn2,4p gene transcriptions|Stress-response elements]]
+(STREs)
+|| CCCCT || Y || Negative strand, negative direction: CCCCT at 2924
+Positive strand, negative direction: CCCCT at 3059
+|-
+|221. [[TACTAAC box gene transcriptions|TACTAAC boxes]] || TACTAA(C/T) || Y || Positive strand, positive direction: TACTAAT at 4157, ATTAGTA at 4148
+|-
+|222. [[TATA box gene transcriptions|TATA boxes]] || TATA(A/T)A(A/T)(A/G) || Y || Negative strand, negative direction: TTTATATA at 2871
+Positive strand, negative direction: TATATAAA at 2874
 |-
-| [[TATC box gene transcriptions|TATCCAC boxes]] || TATCCAC || N || GA responsive complex component
+|223. [[TATC box gene transcriptions|TATCCAC boxes]] || TATCCAC || N || GA responsive complex component
 |-
-| [[TCCACCATA element gene transcriptions|TCCACCATA elements]] || TCCACCATA || N || adjacent co-dependent regulatory element of POLLEN1
+|224. [[TCCACCATA element gene transcriptions|TCCACCATA elements]] || TCCACCATA || N || adjacent co-dependent regulatory element of POLLEN1
 |-
-| [[Tec1p gene transcriptions|Tec1ps]] || GAATGT || ⌘F || Ste12p cofactor
+|225. [[Tec1p gene transcriptions|Tec1ps]] || GAATGT || ⌘F || Ste12p cofactor
 |-
-| [[Tetradecanoylphorbol-13-acetate response element gene transcriptions|Tetradecanoylphorbol-13-acetate response elements]]
+|226. [[Tetradecanoylphorbol-13-acetate response element gene transcriptions|Tetradecanoylphorbol-13-acetate response elements]]
 (TREs)
 || TGA(G/C)TCA || N || ''cis''-regulatory element of the human metallothionein IIa (hMTIIa) promoter and SV40
 |-
-| [[TC element gene transcriptions|TGF-β control elements]]
+|227. [[TC element gene transcriptions|TGF-β control elements]]
 (TCEs)
 || GAGTGGGGCG || ⌘F || in mouse and rat, GCGTGGGGGA in humans
 |-
-| [[TC element gene transcriptions|TGF-β inhibitory elements]]
+|228. [[TC element gene transcriptions|TGF-β inhibitory elements]]
 (TIEs)
 || GAGTGGTGA || N || in the rat transin/stromelysin promoter
 |-
-| [[Thyroid hormone response element gene transcriptions|Thyroid hormone response elements]]
+|229. [[Thyroid hormone response element gene transcriptions|Thyroid hormone response elements]]
 (TREs)
 || AGGTCA || ⌘F || See VDREs, X boxes
 |-
-| [[Unfolded protein response element gene transcriptions|Unfolded protein response elements]]
+|230. [[Hac1p gene transcriptions|Unfolded protein response element]]
+(URE) (UPRE-1)
+|| CANCNTG || Y || Positive strand, negative direction: CAGCCTG at 4348, CATGGTG at 4109, CAGCCTG at 4036, CATCCTG at 3905, CACCCTG at 3743, CAGCCTG at 3297, CAAGGTG at 3143, CAGCCTG at 3127
+|-
+|231. [[Unfolded protein response element gene transcriptions|Unfolded protein response elements]]
 (UPREs)
 || TGACGTG(G/A) || ⌘F || XBP1 binds to UPRE
 |-
-| [[Vhr1p gene transcriptions|Vhr1ps]] || AATCA-N<sub>8</sub>-TGA(C/T)T || ⌘F || Response to low biotin [71] concentrations
+|232. [[Upstream stimulatory factor gene transcriptions|Upstream stimulating factors]]
+(USFs)
+|| GCC(A/T)NN(C/G/T)(A/G) || Y || Negative strand, negative direction: CGGTCCAC at 3953
+Positive strand, negative direction: CAGATGGC at 3629
 |-
-| [[Vitamin D response element gene transcriptions|Vitamin D response elements]]
+|233. [[V box gene transcriptions|V boxes]] || (A/G)TT(A/T)(C/T) || Y || Negative strand, negative direction: ATAAT at 4538, AAAAT at 4512, GTTTC at 4504, GAAAC at 4462, GTTTT at 4376, GTTTT at 4310, ATTAT at 4223, GTTTT at 4216
+Positive strand, negative direction: ATTTT at 4511, AAAAC at 4396, AAAAC at 4311, ATAAT at 4225, ATAAT at 4222, AAAAT at 4219
+|-
+|234. [[Vhr1p gene transcriptions|Vhr1ps]] || AATCA-N<sub>8</sub>-TGA(C/T)T || ⌘F || Response to low biotin [71] concentrations
+|-
+|235. [[Vitamin D response element gene transcriptions|Vitamin D response elements]]
 (VDREs)
 || (A/G)G(G/T)(G/T)CA || ⌘F || AGGTCA not ⌘F
 |-
-| [[X box gene transcriptions|X boxes]] || GTTGGCATGGCAAC || N || X2 box is AGGTCCA not ⌘F
+|236. [[W box gene transcriptions|W boxes]] || (C/T)TGAC(C/T) || Y || Negative strand, negative direction: GGTCAA at 4416, GGTCAA at 4308, CTGACC at 3749
 |-
-| [[Xbp1p gene transcriptions|Xbp1ps]] || GcCTCGA(G/A)G(C/A)g(a/g) || ⌘F || Transcriptional repressor
+|237. [[X box gene transcriptions|X boxes]] || GTTGGCATGGCAAC || N || X2 box is AGGTCCA not ⌘F
 |-
-| [[Xenobiotic response element gene transcriptions|Xenobiotic response elements]]
+|238. [[Xbp1p gene transcriptions|Xbp1ps]] || GcCTCGA(G/A)G(C/A)g(a/g) || ⌘F || Transcriptional repressor
+|-
+|239. [[X core promoter element gene transcriptions|X core promoter elements]] || (A/G/T)(C/G)G(C/T)GG(A/G)A(C/G)(A/C) || Y || Negative strand, negative direction: TGGTGGGACC at 3744
+|-
+|240. [[Xenobiotic response element gene transcriptions|Xenobiotic response elements]]
+(XREs)
+|| GCGTG || Y || Positive strand, negative direction: CACGC at 3280, GCGTG at 3046
+|-
+|241. [[Xenobiotic response element gene transcriptions|Xenobiotic response elements]]
 (XREs)
 || (T/G)NGCGTG(A/C)(G/C)A || ⌘F || contains the core sequence GCGTG
 |-
-| [[Yap1p,2p gene transcriptions|Yap1p,2ps]] || TTACTAA || ⌘F || Yap1p binding sites
+|242. [[Yap1p,2p gene transcriptions|Yap1p,2ps]] || TTACTAA || ⌘F || Yap1p binding sites
+|-
+|243. [[Y box gene transcriptions|Y boxes]] || (A/G)CTAACC(A/G)(A/G)(C/T) || N || inverted CAAT box
 |-
-| [[Y box gene transcriptions|Y boxes]] || (A/G)CTAACC(A/G)(A/G)(C/T) || N || inverted CAAT box
+|244. [[Zap1p gene transcriptions|Zap1ps]] || ACCCTCA || ⌘F || ACC(C/T)(C/T)(A/C/G/T)AAGGT
 |-
-| [[Zap1p gene transcriptions|Zap1ps]] || ACCCTCA || ⌘F || ACC(C/T)(C/T)(A/C/G/T)AAGGT
+|245. [[Z box gene transcriptions|Z boxes]] || A(C/T)A(C/G)GT(A/G)T || Y || Positive strand, negative direction: ACACCTGT at 3970, ATACCTAT at 2996
 |-
 |}

A1BG response element gene transcriptions: Difference between revisions

Revision as of 00:28, 25 February 2021

Hypotheses

Response element testing

Acknowledgements

See also

References

External links

Navigation menu

Search