A1BG response element gene transcriptions: Difference between revisions
Jump to navigation
Jump to search
| Line 162: | Line 162: | ||
|| GGCCAA || N || Activating protein 2 (AP-2)<ref name=Yao/> | || GGCCAA || N || Activating protein 2 (AP-2)<ref name=Yao/> | ||
|- | |- | ||
|17 | |17. [[Activating transcription factor gene transcriptions|Activating transcription factors]] | ||
(Burton) | (Burton) | ||
|| (A/C/G)TT(A/G/T)C(A/G)TCA || Y || - | || (A/C/G)TT(A/G/T)C(A/G)TCA || Y || - | ||
|- | |- | ||
| | |18. [[Activating transcription factor gene transcriptions|Activating transcription factors]] | ||
(Kilberg) | (Kilberg) | ||
|| (A/G/T)TT(A/G/T)CATCA || Y || - | || (A/G/T)TT(A/G/T)CATCA || Y || - | ||
|- | |||
|19. [[Adenylate–uridylate rich element gene transcriptions|Adenylate–uridylate rich elements]] | |||
(Bakheet) | |||
|| (A/T)(A/T)(A/T)TATTTAT(A/T)(A/T) || Y || Negative strand, negative direction: TTTTATTTATTA at 4076 | |||
|- | |- | ||
|20. [[Adr1p gene transcriptions|Adr1ps]] || TTGG(A/G)G || Y || - | |20. [[Adr1p gene transcriptions|Adr1ps]] || TTGG(A/G)G || Y || - | ||
| Line 190: | Line 188: | ||
|| CATGN<sub>6</sub>C(A/T)TG || Y || - | || CATGN<sub>6</sub>C(A/T)TG || Y || - | ||
|- | |- | ||
|24. [[Alpha-amylase conserved element gene transcriptions|Alpha-amylase conserved elements]] || TATCCA || N || TATCCATCCATCC<ref name=Sharma>{{ cite journal | |24. [[Xenobiotic response element gene transcriptions|AhR-responsive elements]] | ||
(AHRE) | |||
(Yao) | |||
|| (G/T)NGCGTG(A/C)(C/G)A || N || in the promoter region of AhR responsive genes | |||
|- | |||
|25. [[Alpha-amylase conserved element gene transcriptions|Alpha-amylase conserved elements]] || TATCCA || N || TATCCATCCATCC<ref name=Sharma>{{ cite journal | |||
|author=Bhaskar Sharma | |author=Bhaskar Sharma | ||
|author2=Joemar Taganna | |author2=Joemar Taganna | ||
| Line 206: | Line 211: | ||
|accessdate=27 August 2020 }}</ref> | |accessdate=27 August 2020 }}</ref> | ||
|- | |- | ||
| | |26. [[Amino acid response element gene transcriptions|Amino acid response elements]] | ||
(AARE) | (AARE) | ||
| Line 213: | Line 218: | ||
|| ATTGCATCA || N || AARE1 (ATTGCATCA)<ref name=Maruyama/> | || ATTGCATCA || N || AARE1 (ATTGCATCA)<ref name=Maruyama/> | ||
|- | |- | ||
| | |27. [[Amino acid response element gene transcriptions|Amino acid response elements]] | ||
(AARE) | (AARE) | ||
| Line 256: | Line 261: | ||
|accessdate=5 September 2020 }}</ref> | |accessdate=5 September 2020 }}</ref> | ||
|- | |- | ||
| | |28. [[Amino acid response element gene transcriptions|Amino acid response element-like]] | ||
(AARE-like) | (AARE-like) | ||
| Line 277: | Line 282: | ||
|accessdate=4 October 2020 }}</ref> | |accessdate=4 October 2020 }}</ref> | ||
|- | |- | ||
| | |29. [[Androgen response element gene transcriptions|Androgen response elements]] | ||
(AREs) | (AREs) | ||
| Line 306: | Line 311: | ||
|accessdate=3 October 2020 }}</ref> | |accessdate=3 October 2020 }}</ref> | ||
|- | |- | ||
| | |30. [[Androgen response element gene transcriptions|Androgen response elements]] | ||
(Kouhpayeh) | (Kouhpayeh) | ||
| Line 313: | Line 318: | ||
Positive strand: GGTACA at 3901, GGTACA at 3336, GGTACA at 2474 | Positive strand: GGTACA at 3901, GGTACA at 3336, GGTACA at 2474 | ||
|- | |- | ||
| | |31. [[Androgen response element gene transcriptions|Androgen response elements]] | ||
(Wilson) | (Wilson) | ||
| Line 335: | Line 340: | ||
Positive strand: AGAACA at 3668, AGAACA at 287, TGTTCT at 45 | Positive strand: AGAACA at 3668, AGAACA at 287, TGTTCT at 45 | ||
|- | |- | ||
| | |32. [[Androgen response element gene transcriptions|Androgen response elements]] | ||
(AREs) | (AREs) | ||
| Line 342: | Line 347: | ||
|| TGATTCGTGAG || N || AGAACANNNTGTTCT<ref name=Wilson/> | || TGATTCGTGAG || N || AGAACANNNTGTTCT<ref name=Wilson/> | ||
|- | |- | ||
| | |33. [[Antioxidant-electrophile responsive element gene transcriptions|Antioxidant-electrophile responsive elements]] | ||
(Lacher) | (Lacher) | ||
|| GC(A/C/T)(A/G/T)(A/G/T)(C/G/T)T(A/C)A || Y || - | || GC(A/C/T)(A/G/T)(A/G/T)(C/G/T)T(A/C)A || Y || - | ||
|- | |- | ||
| | |34. [[Antioxidant-electrophile responsive element gene transcriptions|Antioxidant-electrophile responsive elements]] | ||
(Otsuki) | (Otsuki) | ||
| Line 388: | Line 393: | ||
|accessdate=6 October 2020 }}</ref>, an antioxidant response element (ARE) | |accessdate=6 October 2020 }}</ref>, an antioxidant response element (ARE) | ||
|- | |- | ||
| | |35. [[ATA box gene transcriptions|ATA boxes]] || AATAAA || Y || - | ||
|- | |||
|36. [[Adenylate–uridylate rich element gene transcriptions|ATTTA elements]] | |||
(Siegel) | |||
|| ATTTA || Y || Positive strand, negative direction: ATTTA at 4535 | |||
|- | |- | ||
| | |37. [[Auxin response factor gene transcriptions|Auxin response factors]] | ||
(Ulmasov) | (Ulmasov) | ||
Revision as of 05:11, 26 March 2021
Associate Editor(s)-in-Chief: Henry A. Hoff
Def. nucleotide "sequences, usually upstream, which are recognized by specific regulatory transcription factors, thereby causing gene response to various regulatory agents", [that] "may be found in both promoter and enhancer regions"[1] are called response elements.
Hypotheses
- A1BG has no response elements in either promoter.
- A1BG is not transcribed by a response element.
- Each response element does not participate in the transcription of A1BG.
Response element testing
| Name of elements | Consensus sequences | Testing | Notes |
|---|---|---|---|
| Abbreviations | variations | Present (Y), Absent (N) | |
| Authors | |||
| 1. ABA responsive elements
(ABREs) |
ACGTG(G/T)C | Y | - |
| 2. novel ABA-response elements
(ABREN, novel ABRE) |
GATCGATC, CGATCGAT, GATCGAT | N | ABREN, CGATCGAT motif, and core of ABREN and CGATCGAT motif.[2] |
| 3. ABA-response element-like
(ABRE-like) |
ACGTGTCC | N | third highest scoring motif[2] |
| 4. Activated B-cell Factor-1s
(ABFs) |
CGTNNNNN(A/G)(C/T)GA(C/T) | Y | - |
| 5. Abf1 regulatory factors | CGTCCTCTACGAT | N | CGTNNNNNACGAT[3] |
| 6. A boxes | TACGTA | Y | - |
| 7. boxes A | TGACTCT | Y | - |
| 8. Abscisic acid-responsive elements (Pho4s), G boxes | CACGTG[4] | Y | - |
| 9. ACGT-containing elements | ACGT | Y | - |
| 10. Activating protein 2
(AP2) (Cohen) |
GCCTGGCC | Y | - |
| 11. Activating protein 2
(Cohen) |
TCCCCCGCCC | Y | - |
| 12. Activating protein 2
(Murata) |
(C/G)CCN(3,4)GG(C/G) | Y | - |
| 13. Activating proteins
(Murata) |
GCCCACGGG | N | Activating protein 2[5] |
| 14. Activating protein 2
(Yao) |
TCTTCCC | Y | - |
| 15. Activating protein 2
(Yao) |
CTCCCA | Y | - |
| 16. Activating proteins
(AP-2) (Yao) |
GGCCAA | N | Activating protein 2 (AP-2)[6] |
| 17. Activating transcription factors
(Burton) |
(A/C/G)TT(A/G/T)C(A/G)TCA | Y | - |
| 18. Activating transcription factors
(Kilberg) |
(A/G/T)TT(A/G/T)CATCA | Y | - |
| 19. Adenylate–uridylate rich elements
(Bakheet) |
(A/T)(A/T)(A/T)TATTTAT(A/T)(A/T) | Y | Negative strand, negative direction: TTTTATTTATTA at 4076 |
| 20. Adr1ps | TTGG(A/G)G | Y | - |
| 21. Aft1s | (C/T)(A/G)CACCC(A/G) | Y | - |
| 22. AGC boxes | AGCCGCC | Y | - |
| 23. AhR responsive element
(AHRE-II) |
CATGN6C(A/T)TG | Y | - |
| 24. AhR-responsive elements
(AHRE) (Yao) |
(G/T)NGCGTG(A/C)(C/G)A | N | in the promoter region of AhR responsive genes |
| 25. Alpha-amylase conserved elements | TATCCA | N | TATCCATCCATCC[7] |
| 26. Amino acid response elements
(AARE) (Maruyama) |
ATTGCATCA | N | AARE1 (ATTGCATCA)[8] |
| 27. Amino acid response elements
(AARE) (Broer) |
TTTGCATCA | N | TTTGCATCA.[9][10] |
| 28. Amino acid response element-like
(AARE-like) |
TGGTGAAAG | N | AARE-like sequence (TGGTGAAAG, named AARE3)[8] |
| 29. Androgen response elements
(AREs) (Kouhpayeh) |
GGTACANNNTGTTCT[11] | N | GGTACACGGTGTTCT[11] |
| 30. Androgen response elements
(Kouhpayeh) |
GGTACAnnnTGTTCT | Y | Positive strand: TGTTCT at 45, Negative strand: TGTTCT at 108
Positive strand: GGTACA at 3901, GGTACA at 3336, GGTACA at 2474 |
| 31. Androgen response elements
(Wilson) |
AGAACANNNTGTTCT[12] | Y | Negative strand: TGTTCT at 3759, TGTTCT at 3635, TGTTCT at 3340, TGTTCT at 3307; AGAACA at 4068, AGAACA at 3094, TGTTCT at 108, AGAACA at 281
Positive strand: AGAACA at 3668, AGAACA at 287, TGTTCT at 45 |
| 32. Androgen response elements
(AREs) (Wilson) |
TGATTCGTGAG | N | AGAACANNNTGTTCT[12] |
| 33. Antioxidant-electrophile responsive elements
(Lacher) |
GC(A/C/T)(A/G/T)(A/G/T)(C/G/T)T(A/C)A | Y | - |
| 34. Antioxidant-electrophile responsive elements
(Otsuki) |
GTGAGGTCGC | N | GTGAGGTCGC[13] or GCTGAGT, GCAGGCT of GC(A/C/T)(A/G/T)(A/G/T)(C/G/T)T(A/C)A[14], an antioxidant response element (ARE) |
| 35. ATA boxes | AATAAA | Y | - |
| 36. ATTTA elements
(Siegel) |
ATTTA | Y | Positive strand, negative direction: ATTTA at 4535 |
| 37. Auxin response factors
(Ulmasov) |
TGTCTC | Y | - |
| 36. Auxin response factors
(Boer) |
TGTCGG | Y | - |
| 37. B-boxes
(Johnson) |
TGGGCA | Y | - |
| 38. boxes B
(Sanchez) |
TGTCTCA | Y | - |
| 39. B recognition elements
(BREu) |
(G/C)(G/C)(G/A)CGCC | Y | - |
| 40. CAAT boxes | (C/T)(A/G)(A/G)CCAATC(A/G) | N | consensus sequence for the CCAAT-enhancer-binding site (C/EBP) is TAGCATT |
| 41. CadC binding domains | TTANNNNT | Y | - |
| 42. Calcineurin-responsive transcription factors | TG(A/C)GCCNC | Y | - |
| 43. Calcium-response elements | CTATTTCGAG | N | CaRE1 CTATTTCGAG[15] |
| 44. Carbohydrate response elements
(ChREs) |
CACGTGACCGGATCTTG, TCCGCCCCCATCACGTG | N | ChoRE1, ChoRE2[16] |
| 45. Carbohydrate response elements | ChoRE1 ACCGG, ChoRE2 CCCAT | Y | - |
| 46. Carbon source-responsive elements
(CSREs) |
CATTCATCCG | N | confers carbon source-dependent regulation |
| 47. CAACTC regulatory elements
(CAREs) |
CAACTC | Y | - |
| 48. cAMP-responsive elements
(CREs), Aca1ps, Sko1ps |
TGACGTCA | Y | same as Root specific elements |
| 49. CArG boxes | CCAAAAAT(G/A)G | Y | - |
| 50. Cat8ps | CGG(A/C/G/T)(C/G/T)(A/C/G/T)(A/C/G)(A/C)(A/C/T)GGA | Y | - |
| 51. CAT boxes | CATTCCT | Y | - |
| 52. Cbf1 regulatory factors | TCACGTGA | N | strongly bound Cbf1 motifs enriched at both ends with a "T" on the 5′ and "A" on the 3′ end |
| 52. C-boxes
(Johnson) |
GAGGCCATCT | N | GAGGCCATCT[17] |
| 53. C boxes
(Samarsky) |
AGTAGT | Y | - |
| 54. C-boxes
(Song) |
GACGTC | Y | - |
| 55. C/A hybrid boxes | TGACGTAT | N | TGACGTAT[18] A at the 12 position |
| 56. hybrid C/G-boxes
(Song) |
TGACGTGT | Y | - |
| 57. C/T hybrid boxes | TGACGTTA | N | TGACGTTA[18] T at the 12 position |
| 58. C boxes
(Voronina) |
GGTGATG | Y | - |
| 59. CCAAT-boxes-binding transcription factors
(Hap4p) |
CCAAT | Y | - |
| 60. CCCTC-binding factors
(CTCF) |
NCA-NNA-G(A/G)N-GGC-(A/G)(C/G)(C/T) | N | NCA-NNA-G(G/A)N-GGC-(G/A)(C/G)(T/C)[19] |
| 61. C/EBP boxes | TTAGGACAT,[20] or TAGCATT[6] | N | CCAAT-enhancer-binding site (C/EBP) is TAGCATT |
| 62. Cell cycle regulation | CCCAACGGT[7] | N | tomato genome-wide analysis |
| 63. CENP-B boxes | TTTCGTTGGAAGCGGGA | N | specifically localized at the centromere |
| 64. CGCG boxes | (A/C/G)CGCG(C/G/T) | Y | - |
| 65. Circadian control elements | CAANNNNATC | Y | - |
| 66. Class C DNA binding sites | CACGNG | Y | Positive strand, negative direction: CACGAG at 4472, CACGAG at 3232 |
| 67. Coupling elements
(CE) |
TGCCACCGG[2] | N | CE1 (Watanabe) |
| 68. Cold-responsive elements | CCGAC | Y | - |
| 69. Coupling elements
(CE1s) (Watanabe) |
GCGTGTC | Y | - |
| 68. Coupling elements
(CE3s) (Ding) |
CACGCG | Y | - |
| 70. DAF-16 binding elements | (A/G)(C/T)AAA(C/T)A | Y | - |
| 71. DAF-16-associated elements
(DAE) |
TGATAAG | N | DAF-16-associated element (DAE)[21] |
| 72. D-boxes
(Mracek1) |
GTTGTATAAC | N | GTTGTATAAC[22] |
| 73. D-boxes
(Mracek) |
CTTATGTAAA (Mracek2) | N | CTTATGTAAA[22] |
| 74. D-boxes
(Johnson) |
TCTCACA | N | TCTCACATT(A/C)AATAAGTCA is a D-box.[17] |
| 75. D boxes
(Samarsky) |
AGTCTG | Y | - |
| 76. D boxes
(Voronina) |
TCCTG | Y | - |
| 77. D-boxes
(Motojima) |
TGAGTGG | Y | - |
| 78. Dioxin-responsive elements
(DREs) |
TNGCGTG | Y | - |
| 79. Defense and stress-responsive elements | ATTTTCTTCA | N | (ATTTTCTTCA)[7] |
| 80. DNA damage response elements
(DREs) (Smith) |
TTTCAAT[23] | N | in the upstream repression sequence (URS) |
| 81. DNA damage response elements
(DRE, core) (Sumrada) |
CCGCC | Y | - |
| 82. DNA damage response elements
(DREs) (Sumrada) |
TAGCCGCCG of TAGCCGCCGRRRR[24] | N | in the upstream repression sequence (URS) |
| 83. DNA replication-related elements
(DREs) |
TATCGATA | N | DNA replication-related element (DRE)[25] |
| 84. Downstream B recognition elements | (A/G)T(A/G/T)(G/T)(G/T)(G/T)(G/T) | Y | - |
| 85. Downstream core elements
(DCEs) |
CTTC...CTGT...AGC | Y | - |
| 86. Downstream promoter elements
(DPEs) |
(A/G)G(A/T)(C/T)(A/C/G)T | Y | - |
| 87. DREB boxes | TACCGACAT | N | CRT/DREB box |
| 88. E2 boxes | (G/A)CAG(A/C/G/T)TG(A/C/G/T) | Y | - |
| 89. EIF4E basal elements | TTACCCCCCCTT | N | poly(C) motif |
| 90. EIN3 binding sites | A(C/T)G(A/T)A(C/T)CT | Y | - |
| 91. Endoplasmic reticulum stress response elements
(ERSE) |
CCAAT | N | CCAATGGGCTGAAAC between ZNF497 and A1BG, compare CCAAT-box and ERSE below |
| 92. Endoplasmic reticulum stress response elements | CCAAT-N9-CCACG, CCACG | Y | - |
| 93. Endosperm expressions | TGTGTCA | Y | - |
| 94. Enhancer boxes | CA(A/C/G/T)(A/C/G/T)TG | Y | - |
| 95. Estrogen response elements
(EREs) |
AGGTTA or GGTCAGGAT | N | AGGTTATTGCCTCCT or GGTCAGGATGAC |
| 96. Ethylene responsive elements | ATTTCAAA | Y | - |
| 97. F boxes | TGATAAG[26] | N | F-box overlaps the I-box |
| 98. Forkhead boxes | GTAAACAA[27] | N | GTAAACAA FOXO1 |
| 99. Forkhead boxes | (A/G)(C/T)AAA(C/T)A | Y | - |
| 100. GAAC elements | GAACT | Y | - |
| 101. Gal4ps | CGGACCGC | N | CGG(A/G)NN(A/G)C(C/T)N(C/T)NCNCCG[28] |
| 102. γ-interferon activated sequences
(GAS) |
TTCCTAGAA | N | ALS-GAS1 between nt −633 and nt −625 |
| 103. Γ-interferon activated sequences
(GAS), see STAT5 |
TTNCNNNAA | Y | - |
| 104. GATA boxes | GATA | Y | - |
| 105. G boxes | (G/T)CCACGTG(G/T)C | N | no "perfect palindrome" G boxes in either promoter |
| 106. GC boxes
(Briggs) |
(G/T)(G/A)GGCG(G/T)(G/A)(G/A)(C/T) | Y | - |
| 107. GC boxes
(Ye) |
GGGCGG | Y | Negative strand, negative direction: CCGCCC at 4000, CCGCCC at 3091 |
| 108. GCC boxes | GCCGCC | Y | - |
| 109. General control nonderepressible 4 protein binding site
(GCRE, GCN4) |
TGA(C/G/T)T(A/C/G)(A/T) | Y | - |
| 110. GCN4 motifs | TGACTCA, TGAGTCA | N | ACGT motif |
| 111. Gcn4ps | ATGACTCTT[28] | N | GCN4 motifs |
| 112. Gibberellic acid responsive elements
(GAREs) |
TAACAAA | Y | - |
| 113. Gibberellin responsive elements
(GAREs) (Sharma) |
AAACAGA[7] | Y | - |
| 114. GARE-like 1
(Fan) |
TAACA(A/G)A[29] | Y | - |
| 115. Gibberellin responsive element-like 2
(GARE-like 2) (Fan) |
TAACGTA[29] | N | "in the promoters of hydrolase genes".[29] |
| 116. GLM boxes | (G/A)TGA(G/C)TCA(T/C) | N | GCN4-like motif |
| 117. G-protein-coupled receptors
(GCR1s), CT boxes |
CTTCC | Y | - |
| 118. Glucocorticoid response elements | AGAACA | Y | - |
| 119. Grainy head transcription factor binding sites | AACCGGTT | N | also GACTGGTT |
| 120. GT boxes
(Motojima) |
TGGGTGGGGCT | N | (-78 to -69) |
| 121. GT boxes
(Sato) |
GGGG(T/A)GGGG | Y | Negative strand, Positive direction: GGGGAGGGG at 2291 |
| 122. Hac1 KAR2 | CAGCGTG | Y | Positive strand, negative direction: CAGCGTG at 740, Negative strand, positive direction: CACGCTG at 778 |
| 123. H and ACA boxes | AGAGGA | Y | - |
| 124. Hapless motifs | CCAATCA | N | heterotrimeric transcription factor, HAP2/3/4.[30] |
| 125. H-boxes
(Lindsay) |
CCTACC | Y | - |
| 126. H box
(Mitchell) |
ANANNA | Y | - |
| 127. H box
(Rozhdestvensky) |
ACACCA | Y | - |
| 128. Heat-responsive elements | AAAAAATTTC | N | four nGAAn motifs |
| 129. Heat shock elements
(HSEs) (Eastmond) |
nGAAn-(5-bp)-nGAAnnTTCn | Y | Negative strand, positive direction: GGAATTCACATGAACCTTCA at 332 |
| 130. Heat shock elements
(HSEs) (Eastmond) |
nGA(A/G)n-(5-bp)-nGAAnnTTCn (GAP) | Y | Negative strand, positive direction: GGAATTCACATGAACCTTCA at 332 |
| 131. Heat shock elements
(HSEs) (Eastmond) |
nGAAn-(5-bp)-nGA(A/G)nnTTCn (GAP) | Y | Negative strand, negative direction: GGAATTCACATGAACCTTCA at 332 |
| 132. Heat shock elements
(HSEs) (Eastmond) |
nGAAn-(5-bp)-nGAAn-(5-bp)-nGAAn | Y | Postive strand, negative direction: AGAAGAAAAAAGAAAAGAGAAGAAA at 2831 |
| 133. Heat shock elements
(HSE1) (Eastmond) |
nGAAnnTTCnnGAAn | N | HSE1 |
| 134. Heat shock elements
(HSE2) (Eastmond) |
nTTCnnGAAnnTTCn | N | HSE2 is the inverse complement of HSE1 |
| 135. Heat shock elements
(HSE5) (Eastmond) |
nTTCn-(5-bp)-nTTCnnGAAn | N | HSE5 |
| 136. Heat shock elements
(HSE6) (Eastmond) |
nTTCn-nnGAAn-(5-bp)-nGAAn | N | HSE6 |
| 137. Heat shock elements
(HSE7) (Eastmond) |
nGA(A/G)nnTTCnnGAAn | N | HSE7 PFT1 |
| 138. Heat shock elements
(HSE) (Eastmond) |
nGAAnnTTCnnGA(A/G)n | N | HSE7 PFT2 |
| 139. Heat shock elements
(HSE10) (Eastmond) |
nTTCn-(11-bp)-nGAAn-(5 bp)-nGAAn | N | HSE10 |
| 140. Hex sequences | TGACGTGGC | Y | Positive strand, positive direction: TGACGTGGC at 4344 |
| 141. High Mobility Group boxes
(HMG boxes) |
(A/T)(A/T)CAAAG | Y | Positive strand, negative direction: ATCAAAG at 2891 |
| 142. HNF6s | (A/G/T)(A/T)(A/G)T(C/T)(A/C/G)AT(A/C/G/T)(A/G/T) | Y | Positive strand, negative direction: TTATTAATTC at 4542, TTATTAATCG at 4229, TAGTTGATAA at 3527 |
| 143. Homeoboxes | CAAG | Y | - |
| 144. HY boxes | TG(A/T)GGG | Y | Negative strand, negative direction: CCCTCA at 4498, CCCTCA at 3889, CCCACA at 3184
Positive strand, negative direction: TGAGGG at 4558, TGTGGG at 3712, TGAGGG at 3652 |
| 145. Hypoxia-inducible factors | GCCCTACGTGCTGTCTCA[31] | N | composed of HIF-1α and HIF-1β |
| 146. Hypoxia response elements | ACGTG | Y | Negative strand: ACGTG at 4339, CACGT at 3429, ACGTG at 3288, CACGT at 2863
Positive strand: ACGTG at 4237 |
| 147. I boxes | GATAAG | N | GGATGAGATAAGA |
| 148. Initiator elements
(Inrs) |
YYANWYY | Y | Negative strand, negative direction: TTACTCC at 4557, TCACACT at 4361, TCGGACC at 4349, CCAGTTT at 4309, TCGGACC at 4300, GGTCCGA at 4255, CTGCACC at 4238, TCGGTCT at 4233
Positive strand, negative direction: GGAATGA at 4555, TTAATTC at 4542, TCACATT at 4533, AGTCCAA at 4502, CCACTTT at 4461, CCACTCC at 4425, CCACTCC at 4425, CCAGTTC at 4417, AGTGTGA at 4361, CTGCACT at 4340, CCGGACT at 4327, AAAATAA at 4221 |
| 149. Initiator elements
(Inrs) |
BBCABW | Y | Negative strand, negative direction: TCTGGG at 4366, GTCACA at 4359, CCCACT at 4353, TGTGAC at 4336, GTCACT at 4319, TCCAGT at 4307, TCTGCA at 4236
Positive strand, negative direction: AATGAG at 4556, TTCACA at 4531, CCCACT at 4485, TCCACT at 4459, CCCAGA at 4448, TCCACT at 4423, GCCAGT at 4415, TGCACT at 4340, TGCAGT at 4317, GCCAGA at 4233 |
| 150. Initiator-like elements | TTCTCT | Y | Negative strand: AGAGAA at 4527, TTCTCT at 3380 |
| 151. Inositol/choline-responsive elements
(ICRE) (Case) |
CANNTGAAAT | N | version of Lopes, see below |
| 152. Inositol/choline-responsive elements
(ICRE) (Case, Lopes) |
CATGTGAAAT includes the canonical basic helix-loop-helix (bHLH) binding site CANNTG (Lopes et al. 1991) | Y | - |
| 153. Inositol/choline-responsive elements
(ICRE) (Lopes) |
ATGTGAAAT | N | using ANNTGAAAT |
| 154. Inositol/choline-responsive elements
(ICREs) (Schwank) |
TYTTCACATGY contains the core sequence CANNTG | Y | - |
| 155. Interferon regulatory factor
(IFF3) |
GCTTTCC | Y | - |
| 156. Jasmonic acid-responsive elements
(JAREs) |
TGACG | Y | - |
| 157. Kozak sequences | GCCGCC(A/G)CCATGG | N | GCCGCC(A/G)CCATGG[32] |
| 158. Kozak sequences
(Matsumoto) |
GAAAATGG | N | GAAAATGG[33] |
| 159. Krüppel-like factors | GGGNN(G/T)(G/T)(G/T) | Y | - |
| 160. L boxes | AAATTAACCAA | N | AAATTAACCAA[34] |
| 161. -35 sequence | TTGACA | Y | Negative strand: TTGACA at 4399 |
| 162. Maf recognition element
(MAREs) |
TGCTGA(G/C)TCAGCA | N | and TGCTGA(GC/CG)TCAGCA[35] |
| 163. M boxes | GTCATGTGCT | N | or AGTCATGTGCT[36] |
| 164. Mcm1 regulatory factors | TT(A/T)CCNN(A/T)TNGG(A/T)AA | N | Primary consensus sequence apparently: TT(A/T)CCNN(A/T)TNGG(A/T)AA.[3] |
| 165. Met31ps | AAACTGTG[37] | Y | Positive strand, negative direction: AAACTGTG at 4400 |
| 166. Metal responsive elements
(MRE) |
TGC(A/G)C(A/C/G/T)C | Y | Positive strand: TGCACTC at 4341, TGCACTC at 3290, GTGTGCA at 2863 |
| 167. Middle sporulation element
(MSE) (Branco) |
ACACAAA | Y | Negative strand, negative direction: TTTGTGT at 3513 |
| 168. Midsporulation element
(MSE) (Ozsarac) |
C(A/G)CAAA(A/T) | Y | Negative strand, negative direction: TTTTGTG at 3512
Positive strand, negative direction: CACAAAA at 3767 |
| 169. Multicopy inhibitor of the GAL1 promoter
(MIG1) |
(C/G)(C/T)GGGG | Y | Negative strand, negative direction: GTGGGG at 4445, GTGGGG at 3058
Positive strand, negative direction: CCCCAG at 4447, CTGGGG at 3037 |
| 170. Motif ten elements | C(C/G)A(A/G)C(C/G)(C/G)AACG(C/G) | N | Gene ID: 6309 |
| 171. Myeloblastosis recognition element
(MRE) |
A(A/C)C(A/T)A(A/C)C | Y | Negative strand: GGTAGGT at 4457, ACCAACC at 3946, ACCAACC at 3606, GGTTGTT at 3139 |
| 172. Myocyte enhancer factors
(MEFs) |
(C/T)TA(A/T)(A/T)(A/T)(A/T)TA(A/G) | Y | Negative strand, negative direction: TTATTATTAA at 4226 |
| 173. Nanos/Pumilio response elements
(PREs) |
TGTAAAT | Y | Negative strand, negative direction: TGTAAAT at 4535 |
| 174. N-boxes
(Lee) |
CCGGAA | Y | Negative strand, positive direction: TTCCGG at 4244 |
| 175. N-boxes
(Bai) |
CACGAG | Y | Positive strand, negative direction: CACGAG at 4472, CACGAG at 3232 |
| 176. N-boxes
(Gao) |
CACGGC or CACGAC, CACG(A/G)C | Y | Negative strand, negative direction: CACGAC at 3956, GTCGTG at 3733, GTCGTG at 3072 |
| 177. N-boxes
(Leal) |
CACNAG | Y | Positive strand, negative direction: CACGAG at 4472, CACAAG at 3634, CACTAG at 3493, CACTAG at 3369, CACGAG at 3232 |
| 178. Non-DiTyrosine 80 transcription factor DNA binding domain
(Ndt80) |
(A/G/T)NC(A/G)CAAA(A/T) | Y | Negative strand, negative direction: TTTTGTGTT at 3514
Positive strand: ACCACAAAA at 3767 |
| 179. NF‐κB/Rel family of eukaryotic transcription factors | CCCCTAAGGGG | N | NF-κB |
| 179. Nuclear factor 1
(NF-1) |
TTGGCNNNNNGCCAA | N | palindromic sequence |
| 180. Nuclear factor of activated T cells
(NFATs) |
GGAAAA | Y | Negative strand, negative direction: TTTTCC at 3441, TTTTCC at 3345
Positive strand, negative direction: GGAAAA at 2968, GGAAAA at 2927 |
| 181. Nuclear factor Ys | CCAATGG(A/C)(A/G) | N | NF-Y is a trimeric complex |
| 182. Nutrient-sensing response element 1 | GTTTCATCA | Y | - |
| 183. Oaf1 transcription factor | CGGN3TNAN9-12CCG | Y | - |
| 184. ORESARA1
(ORE1) (Matallana) |
(A/C/G)(A/C)GT(A/G)N5,6(C/T)AC(A/G) | Y | Negative strand, negative direction: GCGTAGAAGACACA at 3558, AAGTAGTTTCTACG at 2895 |
| 185. ORESARA1
(ORE1) (Olsen) |
T(A/G/T)(A/G)CGT(A/G)(A/C/T)(A/G/T) | Y | Negative strand, negative direction: TGACGTGAG at 4341, TAACGTGAG at 3290
Positive strand, negative direction: ATCACGCCA at 3282 |
| 186. p53 response elements | (A/G)(A/G)(A/G)C(A/T)(A/T)G(C/T)(C/T)(C/T) | Y | Positive strand, negative direction: AGACAAGCTT at 4186 |
| 187. p63 DNA binding sites | (A/G)(A/G)(A/G)C(A/G)(A/T)G(C/T)(C/T)(C/T)(A/G)(A/G)(A/G)C(A/T)(C/T)G(C/T)(C/T)(C/T) | N | RRRC(A/G)(A/T)GYYYRRRC(A/T)(C/T)GYYY |
| 188. P-box (Mena) | (A/T)AAAG | Y | Negative strand, negative direction: CTTTT at 4395, CTTTT at 4390, CTTTT at 4383, TAAAG at 3688, TAAAG at 2884
Positive strand, negative direction: AAAAG at 4391, AAAAG at 4386, AAAAG at 4379, AAAAG at 3440, AAAAG at 3344, CTTTT at 3019, TAAAG at 2857 |
| 189. P-box
(Motojima) |
TGAGTTCA | Y | - |
| 190. P-box
(Yu) |
GTAA(T/C) | Y | Negative strand, negative direction: ATTAC at 3658, GTAAT at 3436, GTAAC at 3285, GTAAT at 2951
Positive strand, negative direction: GTAAT at 3973, ATTAC at 3469, GTAAT at 3064 |
| 191. Pdr1p/Pdr3ps | TCCGCGGA | N | Pdr1p/Pdr3p response elements (PDREs) |
| 192. Peroxisome proliferator-activated receptor alpha | CGACCCC | Y | Negative strand, negative direction: CGACCCC at 3037 |
| 193. Peroxisome proliferator hormone response elements
(PPREs) |
AGGTCANAGGTCA | N | PPARs/RXRs heterodimers bind to PPRE |
| 194. Pho4ps | CAC(A/G)T(T/G) | Y | Negative strand, negative direction: TTACAC at 4091, AACGTG at 3288, CACGTT at 2864
Positive strand, negative direction: CACATT at 4533 |
| 195. Pollen1 elements | AGAAA | Y | Negative strand, negative direction: TTTCT at 4505, TTTCT at 4392, TTTCT at 4387, TTTCT at 4380, TTTCT at 4083, TTTCT at 3924, TTTCT at 3665, TTTCT at 3378, TTTCT at 2892
Positive strand, negative direction: AGAAA at 4394, AGAAA at 4389, AGAAA at 4382, AGAAA at 4085, AGAAA at 4081, AGAAA at 3591, AGAAA at 3376, AGAAA at 3342 |
| 196. Pollen1 with TCCACCATA | AGAAANNNNTCCACCATA | N | adjacent co-dependent regulatory element TCCACCATA |
| 197. Polycomb response elements | CGCCAT(A/T)TT | N | CGCCATTT |
| 198. Polycomb response elements
(PRE) |
GCCAT | Y | Positive strand, negative direction: GCCAT at 3685, ATGGC at 3629, GCCAT at 3283, ATGGC at 3005, ATGGC at 2907 |
| 199. Pribnow boxes | TATAAT | Y | Negative strand, negative direction: TATAAT at 3468, TATAAT at 3454 |
| 200. Prolamin boxes | TG(A/T)AAAG | Y | Negative strand, negative direction: TGTAAAG at 2884 |
| 201. Pyrimidine boxes | CCTTTT | Y | Negative strand, negative direction: CCTTTT at 2968, CCTTTT at 2927
Positive strand, negative direction: AAAAGG at 3441, AAAAGG at 3345 |
| 202. Q elements | AGGTCA | Y | Positive strand, negative direction: AGGTCA at 4307 |
| 203. Quinone reductase response element
(QRDRE) (Yao) |
TCCCCT of TCCCCTTGCGTG | Y | - |
| 204. Rap1 regulatory factors | ACCC(A/G)N(A/G)CA | N | "(ACCCRnRCA), less than half of the sites were detectably bound"[3] |
| 205. Rap1 reduced consensus | (A/G)(A/C)ACCC(A/G)N(A/G)C(A/C)(C/T)(A/C) | Y | Positive strand, positive direction: GAACCCACACCTC at 1807 |
| 206. Reb1 bound and exact occurrences | TTACCC(G/T) | Y | Negative strand, negative direction: TTACCCT at 3661 |
| 207. Extended Reb1 | ATTACCCGAA | N | "extended motif VTTACCCGNH (IUPAC nomenclature) (Rhee and Pugh 2011)."[3] |
| 208. Retinoic acid response element | AG(A/G)TCA | Y | Negative strand, negative direction: TGATCT at 3463 |
| 209. Glucose transporter gene repressor
(Rgt1) |
CGG(A/G)(A/T)N(A/T)(A/T) | Y | Negative strand, negative direction: ATTTTCCG at 3442 |
| 210. Rlm1ps | CTATATATAG | N | CTA(T/A)4TAG |
| 211. classic RORE motif
(RORE) |
A(A/T)NTAGGTCA | Y | - |
| 212. variant RORE motif | C(T/A)(G/A)GGNCA | Y | Negative strand, negative direction: CTGGGACA at 4369, CTGGGACA at 4208 |
| 213. Rox1ps | RRRTAACAAGAG | N | Heme-dependent repressor of hypoxic genes.[28] |
| 214. Rpn4ps | GGTGGCAAA | N | proteasome genes |
| 215. R response elements
(RRE) |
CATCTG | Y | Negative strand, negative direction: CAGATG at 4212, CAGATG at 2988
Positive strand, negative direction: CAGATG at 3919, CAGATG at 3627, CAGATG at 3620 |
| 216. Seed-specific elements | CATGCATG | N | SRE consensus: CAGCAGATTGCG is none |
| 217. Serum response elements
(SRE) see CArG boxes |
ACAGGATGT | Y | Negative strand, positive direction: ACAGGATGT at 3575 |
| 218. Servenius sequences | GGACCCT | Y | Negative strand, negative direction: GGACCCT at 4548, GGACCCT at 4496, GGACCCT at 4302 |
| 219. Shoot specific elements | GATAATGATG | N | SRE consensus: CAGCAGATTGCG is none |
| 220. Sip4ps | CC(C/G)T(C/T)C(C/G)TCCG | N | CC(C/G)T(C/T)C(C/G)TCCG[28] |
| 221. Smp1ps | ACTACTA(A/T)(A/T)(A/T)(A/T)TAG | N | ACTACTA(T/A)4TAG[28] |
| 222. SP1
(Zhang) |
(G/T)GGGCGG(G/A)(G/A)(C/T) | Y | see GC boxes above |
| 223. SP1-box 1
(Motojima) |
GGGGCT | Y | Positive strand, negative direction: GGGGCT at 3039 |
| 224. SP1-box 2
(Motojima) |
CTGCCC | Y | Positive strand, negative direction: CTGCCC at 3853 |
| 225. SP-1
(Sato) |
CCGCCCC | Y | Negative strand, positive direction: GGGGCGG at 4439, GGGGCGG at 4429 |
| 226. SP1
(Yao) |
GCGGC | Y | Negative strand, negative direction: GCCGC at 2726
Positive strand, negative direction: GCGGC at 2725 |
| 227. STAT5 | TTCNNNGAA | Y | Positive strand, negative direction: TTCCCTGAA at 3782, TTCGTTGAA at 3506 |
| 228. Sterol response elements
(Branco) |
TCGTATA | N | perhaps plant specific |
| 229. Sterol response elements
(Yao) |
AGCAGATTGCG | N | liver specific |
| 230. Stress-response elements
(STREs) |
CCCCT | Y | Negative strand, negative direction: CCCCT at 2924
Positive strand, negative direction: CCCCT at 3059 |
| 231. Sucrose boxes | NNAATCA | Y | Negative strand, negative direction: TGATTCC at 3474, TGATTTT at 3163, TGATTCG at 3032, TGATTCG at 2915 |
| 232. TACTAAC boxes | TACTAA(C/T) | Y | Positive strand, positive direction: TACTAAT at 4157, ATTAGTA at 4148 |
| 233. TAGteams | CAGGTAG | Y | Negative strand, positive direction: CAGGTAG at 4035, CTACCTG at 1198 |
| 234. Tapetum boxes | TCGTGT | Y | Negative strand, negative direction: ACACGA at 4402, TCGTGT at 3915 |
| 235. TATA boxes | TATA(A/T)A(A/T)(A/G) | Y | Negative strand, negative direction: TTTATATA at 2871
Positive strand, negative direction: TATATAAA at 2874 |
| 236. TAT Boxes
(Yang) |
TATAAAA | Y | Negative strand, negative direction: TATAAAA at 2853 |
| 237. TAT Boxes
{Fan) |
TATCCAT | Y | Negative strand, negative direction: ATGGATA at 2996 |
| 238. TATCCAC boxes | TATCCAC | N | GA responsive complex component |
| 239. T boxes
(Conlon) |
TCACACCT | Y | positive strand: TCACACCT at 3968, TCACACCT at 1129 |
| 240. T boxes
(Zhang) |
AACGTT | Y | positive strand: AACGTT at 2691, AACGTT at 1614 |
| 241. TCCACCATA elements | TCCACCATA | N | adjacent co-dependent regulatory element of POLLEN1 |
| 242. Tec1ps | GAATGT | Y | Ste12p cofactor |
| 243. Telomeric repeat DNA-binding factors
(TRFs) |
TTAGGG | Y | Negative strand, negative direction: TTAGGG at 3976, TTAGGG at 3067 |
| 244. Tetradecanoylphorbol-13-acetate response elements
(TREs) |
TGA(G/C)TCA | N | cis-regulatory element of the human metallothionein IIa (hMTIIa) promoter and SV40 |
| 245. TGF-β control elements
(TCEs) |
GAGTGGGGCG | N | in mouse and rat, GCGTGGGGGA in humans |
| 246. TGF-β inhibitory elements
(TIEs) |
GAGTGGTGA | N | in the rat transin/stromelysin promoter |
| 247. Thyroid hormone response elements
(TREs)(THRs) |
AGGTCA | Y | See VDREs, X boxes, Positive strand, negative direction: AGGTCA at 4307 |
| 248. Transcription factor 3
(TCF3) |
GTCTGGT | Y | Negative strand, negative direction: GTCTGGT at 2122 |
| 249. Unfolded protein response element
(URE) (UPRE-1) |
CANCNTG | Y | Positive strand, negative direction: CAGCCTG at 4348, CATGGTG at 4109, CAGCCTG at 4036, CATCCTG at 3905, CACCCTG at 3743, CAGCCTG at 3297, CAAGGTG at 3143, CAGCCTG at 3127 |
| 250. Unfolded protein response elements
(UPREs) |
TGACGTG(G/A) | Y | XBP1 binds to UPRE, Negative strand, negative direction: TGACGTGA at 4340 |
| 251. Upstream stimulating factors
(USFs) |
GCC(A/T)NN(C/G/T)(A/G) | Y | Negative strand, negative direction: CGGTCCAC at 3953
Positive strand, negative direction: CAGATGGC at 3629 |
| 252. V boxes | (A/G)TT(A/T)(C/T) | Y | Negative strand, negative direction: ATAAT at 4538, AAAAT at 4512, GTTTC at 4504, GAAAC at 4462, GTTTT at 4376, GTTTT at 4310, ATTAT at 4223, GTTTT at 4216
Positive strand, negative direction: ATTTT at 4511, AAAAC at 4396, AAAAC at 4311, ATAAT at 4225, ATAAT at 4222, AAAAT at 4219 |
| 253. Vhr1ps
(VHR1) |
AATCA-N8-TGA(C/T)T | N | Response to low biotin concentrations |
| 254. Vitamin D response elements
(VDREs) |
(A/G)G(G/T)(G/T)CA | Y | Negative strand, negative direction: TGAACC at 4268, TGAACT at 4012, TGACCC at 3750, TGAACT at 3242, TGAACT at 3103, TGAACC at 2921 |
| 255. Vitamin D response elements
(VDREs) |
A/GGG/TTCAnnnA/GGG/TTCA | N | (A/G)G(G/T)TCANNN(A/G)G(G/T)TCA |
| 256. W boxes | (C/T)TGAC(C/T) | Y | Negative strand, negative direction: GGTCAA at 4416, GGTCAA at 4308, CTGACC at 3749 |
| 257. X boxes | GTTGGCATGGCAAC[4] | N | X2 box is AGGTCCA not ⌘F |
| 258. X-boxes | GT(A/C/T)N(C/T)(C/T)AT(A/G)(A/G)NAAC[38] | N | includes GTTNCCATGGNAAC |
| 259. Xbp1ps | GcCTCGA(G/A)G(C/A)g(a/g) | N | Transcriptional repressor |
| 260. X core promoter elements | (A/G/T)(C/G)G(C/T)GG(A/G)A(C/G)(A/C) | Y | Negative strand, negative direction: TGGTGGGACC at 3744 |
| 261. Xenobiotic response elements
(XREs) |
GCGTG | Y | Positive strand, negative direction: CACGC at 3280, GCGTG at 3046 |
| 262. Xenobiotic response elements
(XREs) |
(T/G)NGCGTG(A/C)(G/C)A | N | contains the core sequence GCGTG, see AHRE above |
| 263. Yap recognition sequences | TTACTAA | Y | Yap1, Yap2, Yap3, and Yap5 |
| 264. Y boxes | (A/G)CTAACC(A/G)(A/G)(C/T) | N | inverted CAAT box |
| 265. YY1 binding sites | CCATCTT | Y | Negative strand, negative direction: CCATCTT at 1654 |
| 266. Zap1ps | ACCCTCA | N | ACC(C/T)(C/T)(A/C/G/T)AAGGT |
| 267. Z boxes | A(C/T)A(C/G)GT(A/G)T | Y | Positive strand, negative direction: ACACCTGT at 3970, ATACCTAT at 2996 |
| 268. Zinc responsive elements
(ZREs) |
MHHAACCBYNMRGGT | N | (A/C)(A/C/T)(A/C/T)AACC(C/G/T)(C/T)N(A/C)(A/G)GGT |
Acknowledgements
The content on this page was first contributed by: Henry A. Hoff.
See also
References
- ↑ MeSH (8 July 2008). "Response Elements". U.S. National Library of Medicine, 8600 Rockville Pike, Bethesda, MD 20894: National Institutes of Health, Health & Human Services. Retrieved 2 September 2020.
- ↑ 2.0 2.1 2.2 Kenneth A. Watanabe; Arielle Homayouni; Lingkun Gu; Kuan‐Ying Huang; Tuan‐Hua David Ho; Qingxi J. Shen (18 June 2017). "Transcriptomic analysis of rice aleurone cells identified a novel abscisic acid response element". Plant, Cell & Environment. 40 (9): 2004–2016. doi:10.1111/pce.13006. Retrieved 5 October 2020.
- ↑ 3.0 3.1 3.2 3.3 Matthew J. Rossi; William K.M. Lai; B. Franklin Pugh (21 March 2018). "Genome-wide determinants of sequence-specific DNA binding of general regulatory factors". Genome Research. 28: 497–508. doi:10.1101/gr.229518.117. PMID 29563167. Retrieved 31 August 2020.
- ↑ 4.0 4.1 Z G E, Zhang YP, Zhou JH, Wang L (April 2014). "Mini review roles of the bZIP gene family in rice". Genetics and Molecular Research. 13 (2): 3025–36. doi:10.4238/2014.April.16.11. PMID 24782137. Vancouver style error: name (help)
- ↑ Takayuki Murata; Chieko Noda; Yohei Narita1; Takahiro Watanabe; Masahiro Yoshida; Keiji Ashio; Yoshitaka Sato; Fumi Goshima; Teru Kanda; Hironori Yoshiyama; Tatsuya Tsurumi; Hiroshi Kimura (27 January 2016). "Induction of Epstein-Barr Virus Oncoprotein Latent Membrane Protein 1 (LMP1) by Transcription Factors Activating Protein 2 (AP-2) and Early B Cell Factor (EBF)" (PDF). Journal of Virology. doi:10.1128/JVI.03227-15. Retrieved 4 October 2020.
- ↑ 6.0 6.1 Yao EF; Denison MS (June 1992). "DNA sequence determinants for binding of transformed Ah receptor to a dioxin-responsive enhancer". Biochemistry. 31 (21): 5060–7. doi:10.1021/bi00136a019. PMID 1318077.
- ↑ 7.0 7.1 7.2 7.3 Bhaskar Sharma; Joemar Taganna (12 June 2020). "Genome-wide analysis of the U-box E3 ubiquitin ligase enzyme gene family in tomato". Scientific Reports. 10 (9581). doi:10.1038/s41598-020-66553-1. PMID 32533036 Check
|pmid=value (help). Retrieved 27 August 2020. - ↑ 8.0 8.1 Ryuto Maruyama; Makoto Shimizu; Juan Li, Jun Inoue; Ryuichiro Sato (24 March 2016). "Fibroblast growth factor 21 induction by activating transcription factor 4 is regulated through three amino acid response elements in its promoter region". Bioscience, Biotechnology, and Biochemistry. 80 (5): 929–934. doi:10.1080/09168451.2015.1135045. Retrieved 4 October 2020.
- ↑ Angelika Bröer; Gregory Gauthier-Coles; Farid Rahimi; Michelle van Geldermalsen; Dieter Dorsch; Ansgar Wegener; Jeff Holst; Stefan Bröer (March 15, 2019). "Ablation of the ASCT2 (SLC1A5) gene encoding a neutral amino acid transporter reveals transporter plasticity and redundancy in cancer cells" (PDF). Journal of Biological Chemistry. 294 (11): 4012–4026. doi:10.1074/jbc.RA118.006378. Retrieved 4 October 2020.
- ↑ Alisa A. Garaeva; Irina E. Kovaleva; Peter M. Chumakov; Alexandra G. Evstafieva (15 January 2016). "Mitochondrial dysfunction induces SESN2 gene expression through Activating Transcription Factor 4". Cell Cycle. 15 (1): 64–71. doi:10.1080/15384101.2015.1120929. PMID 26771712. Retrieved 5 September 2020.
- ↑ 11.0 11.1 S Kouhpayeh; AR Einizadeh; Z Hejazi; M Boshtam; L Shariati; M Mirian; L Darzi; M Sojoudi; H Khanahmad; A Rezaei (1 July 2016). "Antiproliferative effect of a synthetic aptamer mimicking androgen response elements in the LNCaP cell line" (PDF). Cancer Gene Therapy. 23: 254–257. doi:10.1038/cgt.2016.26. Retrieved 3 October 2020.
- ↑ 12.0 12.1 Stephen Wilson; Jianfei Qi; Fabian V. Filipp (14 September 2016). "Refinement of the androgen response element based on ChIP-Seq in androgen-insensitive and androgen-responsive prostate cancer cell lines". Scientific Reports. 6: 32611. doi:10.1038/srep32611. Retrieved 3 October 2020.
- ↑ Akihito Otsuki; Mikiko Suzuki; Fumiki Katsuoka; Kouhei Tsuchida; Hiromi Suda; Masanobu Morita; Ritsuko Shimizu; Masayuki Yamamoto (February 2016). "Unique cistrome defined as CsMBE is strictly required for Nrf2-sMaf heterodimer function in cytoprotection". Free Radical Biology and Medicine. 91: 45–57. doi:10.1016/j.freeradbiomed.2015.12.005. PMID 26677805. Retrieved 21 August 2020.
- ↑ Sarah E. Lacher; Daniel C. Levings; Samuel Freeman; Matthew Slattery (October 2018). "Identification of a functional antioxidant response element at the HIF1A locus". Redox Biology. 19: 401–411. doi:10.1016/j.redox.2018.08.014. Retrieved 6 October 2020.
- ↑ Xu Tao; Anne E. West; Wen G. Chen; Gabriel Corfas; Michael E. Greenberg (2002). "A calcium-responsive transcription factor, CaRF, that regulates neuronal activity-dependent expression of BDNF". Neuron. 33: 383–95. doi:10.1016/S0896-6273(01)00561-X. PMID 11832226. Retrieved 2 September 2020.
- ↑ Jianyin Long; Daniel L. Galvan; Koki Mise; Yashpal S. Kanwar; Li Li; Naravat Poungavrin; Paul A. Overbeek; Benny H. Chang; Farhad R. Danesh (28 May 2020). "Role for carbohydrate response element-binding protein (ChREBP) in high glucose-mediated repression of long noncoding RNA Tug1" (PDF). Journal of Biological Chemistry. 5 (28). doi:10.1074/jbc.RA120.013228. Retrieved 6 October 2020.
- ↑ 17.0 17.1 PA Johnson; D Bunick; NB Hecht (1991). "Protein Binding Regions in the Mouse and Rat Protamine-2 Genes" (PDF). Biology of Reproduction. 44 (1): 127–134. doi:10.1095/biolreprod44.1.127. PMID 2015343. Retrieved 6 April 2019.
- ↑ 18.0 18.1 Young Hun Song; Cheol Min Yoo; An Pio Hong; Seong Hee Kim; Hee Jeong Jeong; Su Young Shin; Hye Jin Kim; Dae-Jin Yun; Chae Oh Lim; Jeong Dong Bahk; Sang Yeol Lee; Ron T. Nagao; Joe L. Key; Jong Chan Hong (April 2008). "DNA-Binding Study Identifies C-Box and Hybrid C/G-Box or C/A-Box Motifs as High-Affinity Binding Sites for STF1 and LONG HYPOCOTYL5 Proteins" (PDF). Plant Physiology. 146 (4): 1862–1877. doi:10.1104/pp.107.113217. PMID 18287490. Retrieved 26 March 2019.
- ↑ Hideharu Hashimoto; Dongxue Wang; John R. Horton; Xing Zhang; Victor G. Corces; Xiaodong Cheng (1 June 2017). "Structural Basis for the Versatile and Methylation-Dependent Binding of CTCF to DNA". Molecular Cell. 66 (5): 711–720.e3. doi:10.1016/j.molcel.2017.05.004. PMID 28529057. Retrieved 28 August 2020.
- ↑ Ravi P. Misra; Azad Bonni; Cindy K. Miranti; Victor M. Rivera; Morgan Sheng; Michael E.Greenberg (14 October 1994). "L-type Voltage-sensitive Calcium Channel Activation Stimulates Gene Expression by a Serum Response Factor-dependent Pathway" (PDF). The Journal of Biological Chemistry. 269 (41): 25483–25493. PMID 7929249. Retrieved 7 December 2019.
- ↑ Yan-Hui Li; Gai-Gai Zhang (12 April 2016). "Towards understanding the lifespan extension by reduced insulin signaling: bioinformatics analysis of DAF-16/FOXO direct targets in Caenorhabditis elegans". Oncotarget. 7 (15): 19185–19192. doi:10.18632/oncotarget.8313. PMID 2702736. Retrieved 27 August 2020.
- ↑ 22.0 22.1 Philipp Mracek; Cristina Santoriello; M. Laura Idda; Cristina Pagano; Zohar Ben-Moshe; Yoav Gothilf; Daniela Vallone; Nicholas S. Foulkes (December 6, 2012). "Regulation of per and cry Genes Reveals a Central Role for the D-Box Enhancer in Light-Dependent Gene Expression". PLoS ONE. 7 (12): e51278. doi:10.1371/journal.pone.0051278. Retrieved 10 February 2019.
- ↑ Joshua J. Smith, Eric S. Cole, Daniel P. Romero (15 July 2004). "Transcriptional control of RAD51 expression in the ciliate Tetrahymena thermophila". Nucleic Acids Research. 32 (14): 4313–4321. doi:10.1093/nar/gkh771. PMID 15304567. Retrieved 4 September 2020.
- ↑ Roberta A. Sumrada and Terrance G. Cooper (June 1987). "Ubiquitous upstream repression sequences control activation of the inducible arginase gene in yeast" (PDF). Proceedings of the National Academy of Sciences USA. 84: 3997–4001. doi:10.1073/pnas.84.12.3997. PMID 3295874. Retrieved 6 September 2020.
- ↑ Fumiko Hirose; Masamitsu Yamaguchi; Akio Matsukage (September 1999). "Targeted Expression of the DNA Binding Domain of DRE-Binding Factor, a Drosophila Transcription Factor, Attenuates DNA Replication of the Salivary Gland and Eye Imaginal Disc". Molecular and Cellular Biology. 19 (9): 6020–6028. doi:10.1128/MCB.19.9.6020. PMID 10454549. Retrieved 4 September 2020.
- ↑ Annkatrin Rose, Iris Meier and Udo Wienand (28 October 1999). "The tomato I-box binding factor LeMYBI is a member of a novel class of Myb-like proteins". The Plant Journal. 20 (6): 641–652. doi:10.1046/j.1365-313X.1999.00638.x. Retrieved 8 November 2018.
- ↑ Eiji Yoshihara (18 August 2020). "TXNIP/TBP-2: A Master Regulator for Glucose Homeostasis". Antioxidants. 9 (8): 765–84. doi:10.3390/antiox9080765. PMID 32824669 Check
|pmid=value (help). Retrieved 5 September 2020. - ↑ 28.0 28.1 28.2 28.3 28.4 Hongting Tang, Yanling Wu, Jiliang Deng, Nanzhu Chen, Zhaohui Zheng, Yongjun Wei, Xiaozhou Luo, and Jay D. Keasling (6 August 2020). "Promoter Architecture and Promoter Engineering in Saccharomyces cerevisiae". Metabolites. 10 (8): 320–39. doi:10.3390/metabo10080320. PMID 32781665 Check
|pmid=value (help). Retrieved 18 September 2020. - ↑ 29.0 29.1 29.2 Liu-Min Fan, Xiaoyan Feng, Yu Wang and Xing Wang Deng (2007). "Gibberellin Signal Transduction in Rice". Journal of Integrative Plant Biology. 49 (6): 731−741. doi:10.1111/j.1744-7909.2007.00511.x. Retrieved 16 October 2018.
- ↑ Nesrin Ozsarac, Melissa J. Straffon, Hazel E. Dalton, and Ian W. Dawes (March 1997). "Regulation of Gene Expression during Meiosis in Saccharomyces cerevisiae: SPR3 Is Controlled by both ABFI and a New Sporulation Control Element". Molecular and Cellular Biology. 17 (3): 1152–9. doi:10.1128/MCB.17.3.1152. PMC 231840. PMID 9032242.
- ↑ Qingliang Li, Rezaul M. Karim, Mo Cheng, Mousumi Das, Lihong Chen, Chen Zhang, Harshani R. Lawrence, Gary W. Daughdrill, Ernst Schonbrunn, Haitao Ji and Jiandong Chen (July 2020). "Inhibition of p53 DNA binding by a small molecule protects mice from radiation toxicity". Oncogene. 39 (29): 5187–5200. doi:10.1038/s41388-020-1344-y. PMID 32555331 Check
|pmid=value (help). Retrieved 29 August 2020. - ↑ Marilyn Kozak (October 1987). "An analysis of 5'-noncoding sequences from 699 vertebrate messenger RNAs". Nucleic Acids Research. 15 (20): 8125–8148. doi:10.1093/nar/15.20.8125. PMID 3313277.
- ↑ Takuya Matsumoto; Saemi Kitajima; Chisato Yamamoto; Mitsuru Aoyagi; Yoshiharu Mitoma; Hiroyuki Harada; Yuji Nagashima (9 August 2020). "Cloning and tissue distribution of the ATP-binding cassette subfamily G member 2 gene in the marine pufferfish Takifugu rubripes" (PDF). Fisheries Science. 86: 873–887. doi:10.1007/s12562-020-01451-z. Retrieved 27 September 2020.
- ↑ Robert G. K. Donald and Anthony R. Cashmore (1990). "Mutation of either G box or I box sequences profoundly affects expression from the Arabidopsis rbcS‐1A promoter". The EMBO Journal. 9 (6): 1717–1726. doi:10.1002/j.1460-2075.1990.tb08295.x. Retrieved 8 November 2018.
- ↑ Motoki Kyo, Tae Yamamoto, Hozumi Motohashi, Terue Kamiya, Toshihiro Kuroita, Toshiyuki Tanaka, James Douglas Engel, Bunsei Kawakami, Masayuki Yamamoto (13 February 2004). "Evaluation of MafG interaction with Maf recognition element arrays by surface plasmon resonance imaging technique". Genes to Cells. 9 (2). doi:10.1111/j.1356-9597.2004.00711.x. Retrieved 8 September 2020.
- ↑ Corine Bertolotto, Roser Buscà, Patricia Abbe, Karine Bille, Edith Aberdam, Jean-Paul Ortonne, and Robert Ballotti (February 1998). "Different cis-Acting Elements Are Involved in the Regulation of TRP1 and TRP2 Promoter Activities by Cyclic AMP: Pivotal Role of M Boxes (GTCATGTGCT) and of Microphthalmia". Molecular and Cellular Biology. 18 (2): 694–702. PMID 9447965. Retrieved 8 December 2018.
- ↑ Pierre‐Louis Blaiseau and Dominique Thomas (2 November 1998). "Multiple transcriptional activation complexes tether the yeast activator Met4 to DNA". The EMBO Journal. 17: 6327–6336. doi:10.1093/emboj/17.21.6327.
|access-date=requires|url=(help) - ↑ Eduardo Moreno, Maša Lenuzzi, Christian Rödelsperger, Neel Prabh, Hanh Witte, Waltraud Roeseler, Metta Riebesell, Ralf J. Sommer (November/December 2018). "DAF‐19/RFX controls ciliogenesis and influences oxygen‐induced social behaviors in Pristionchus pacificus". Evolution & Development. 20 (6): 233–243. doi:10.1111/ede.12271. Retrieved 9 March 2021. Check date values in:
|date=(help)