Alpha-1-B glycoprotein is a 54.3 kDa protein in humans that is encoded by the A1BG gene.
[3] The protein encoded by this gene is a plasma glycoprotein of unknown function. The protein shows sequence similarity to the variable regions of some immunoglobulin supergene family member proteins. Patients who have pancreatic ductal adenocarcinoma show an overexpression of A1BG in pancreatic juice.[4]
A1BG is located on the negative DNA strand of chromosome 19 from 58,858,172 – 58,864,865.[5] Additionally, A1BG is located directly adjacent to the ZSCAN22 gene (58,838,385-58,853,712)) on the positive DNA strand, as well as the ZNF837 (58,878,990 - 58,892,389, complement) and ZNF497 (58865723 - 58,874,214, complement) genes on the negative strand.[5]
Transcriptions
According to one source, A1BG is transcribed from the direction of ZNF497: 3' - 58864890: CGAGCCACCCCACCGCCCTCCCTTGG+1GGCCTCATTGCTGCAGACGCTCACCCCAGACACTCACTGCACCGGAGTGAGCGCGACCATCATG : 58866601-5',[6] where the second 'G' at left of four Gs in a row is the TSS.[7] Transcription was triggered in cell cultures and the transcription start site was found using reverse transcriptase. But, the mechanism for transcription is unknown.
Controlling the transcription of A1BG may have significant immune function against snake envenomation. A1BG forms a complex that is similar to those formed between toxins from snake venom and A1BG-like plasma proteins which inhibits the toxic effect of snake venom metalloproteinases or myotoxins and protects the animal from envenomation.[8]
The gene contains 20 distinct introns.[10]Transcription produces 15 different mRNAs, 10 alternatively spliced variants and 5 unspliced forms.[10] There are 4 probable alternative promoters, 4 non overlapping alternative last exons and 7 validated alternative polyadenylation sites.[10] The mRNAs appear to differ by truncation of the 5' end, truncation of the 3' end, presence or absence of 4 cassette exons, overlapping exons with different boundaries, splicing versus retention of 3 introns.[10]
Protein
Properties
The San Diego Super Computer's Statistical Analysis of Protein (SAPS) program determined that alpha-1B glycoprotein has 495 amino acids residues, an isoelectric point of 5.47, and a molecular mass of 54.3 kDa. Additionally, it suggested that no transmembrane domains exist in alpha-1B glycoprotein.[11] According to NCBI, the amino acid sequence MLVVFLLLWGVTWGPVTEA is a signal peptide on the N-terminus of the protein that might function as an endoplasmic reticulum import signal.[11]
Post-translational modifications
The NetAcet 1.0 program calculated that the first five amino acid residues serve as an N-acetylation site.[12] The NetGlycate 1.0 program predicted that the lysines located at residue 78, 114, and 227 serve as glycation points.[13] The NetNES 1.1 program predicted the leucine at residue 47 to be a nuclear export signal.[14] The NetNGlyc 1.0 program predicted four N-glycosylation sites - two of which are highly conserved internally repeated sequences.[15][16] The NetCGlyc1.0 program predicted that none of the tryptophan residues serve as C-mannosylation sites.[17]
Protein interactions
A study by Udby et al. showed that Cysteine-rich secretory protein 3 is a ligand of alpha-1B glycoprotein in human plasma and they suggest that the A1BG-CRISP-3 complex displays a similar function in protecting the circulation from a potentially harmful effect of free CRISP-3.[18]
No paralogs have been found for alpha-1B glycoprotein.[32]
Homologous domains
An initial NCBI Blast alignment of alpha-1B glycoprotein illustrates that the protein is mainly composed of three immunoglobulin domains.[33] There is a large segment of amino acids from position 297 to 400 that is not shown to be an immunoglobulin domain. However, a NCBI BLAST alignment of just the amino acids from 297-400 does illustrate that the latter sequence is indeed a fourth immunoglobulin domain.[34] Ultimately, alpha-1B glycoprotein seems to be primarily composed of four immunoglobulin domains.
Clinical significance
Steroid-resistant nephrotic syndrome
The alpha-1-glycoprotein is upregulated 11-fold in the urine of patients who have steroid resistant nephrotic syndrome.[35] A1BG was present in 7/19 patients with SRNS and was absent from all patients with steroid sensitive nephrotic syndrome.[35] The 13.8 kDa A1BG fragment had a high discriminatory power for steroid resistance in pediatric nephrotic syndrome, but is only present in a subset of patients.[35]
Breast cancers
"Alpha-1B-glycoprotein is a secreted glycoprotein with some similarity to the immunoglobulin family and basically very few known functions70. [It] has been described in proteomic studies of several cancer types like breast cancer71, oral squamous carcinoma72, in the serum of non-small cell lung cancer73, and in pancreatic ductal adenocarcinoma74. Here we describe for the first time a negative correlation of alpha-1B-glycoprotein tissue expression to melanoma survival."[36]
↑Michael David Winther, Leah Christine Knickle, Martin Haardt, Stephen John Allen, Andre Ponton, Roberto Justo De Antueno, Kenneth Jenkins, Solomon O. Nwaka, Y. Paul Goldberg (July 29, 2004). Fat Regulated Genes, Uses Thereof and Compounds for Mudulating Same. US Patent Office. Retrieved 2013-02-14.CS1 maint: Multiple names: authors list (link)
↑HGNC (February 5, 2013). A1BG alpha-1-B glycoprotein [ Homo sapiens ]. 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information, U.S. National Library of Medicine. Retrieved 2013-02-14.
↑Udby L, Sørensen OE, Pass J, Johnsen AH, Behrendt N, Borregaard N, Kjeldsen L. (October 2004). "Cysteine-rich secretory protein 3 is a ligand of alpha1B-glycoprotein in human plasma". Biochemistry. 43 (40): 12877–86. doi:10.1021/bi048823e. PMID15461460. |access-date= requires |url= (help)CS1 maint: Multiple names: authors list (link)
↑ 9.09.19.29.3"EST Profile - Hs.529161". UniGene. National Center for Biotechnology Information, U.S. National Library of Medicine. Retrieved 2013-05-11.
↑Udby L, Sørensen OE, Pass J, Johnsen AH, Behrendt N, Borregaard N, Kjeldsen L (October 2004). "Cysteine-rich secretory protein 3 is a ligand of alpha1B-glycoprotein in human plasma". Biochemistry. 43 (40): 12877–86. doi:10.1021/bi048823e. PMID15461460.
↑ 35.035.135.2Piyaphanee N, Ma Q, Kremen O, Czech K, Greis K, Mitsnefes M, Devarajan P, Bennett MR (June 2011). "Discovery and initial validation of α 1-B glycoprotein fragmentation as a differential urinary biomarker in pediatric steroid-resistant nephrotic syndrome". Proteomics: Clinical Applications. 5 (5–6): 334–42. doi:10.1002/prca.201000110. PMID21591266.